Transcript

snx4-202

ID
ZDB-TSCRIPT-090929-15480
Name
snx4-202
Previous Names
  • snx4-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034774 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034774|OTTDARG00000020922|ZDB-GENE-030131-1923 snx4|OTTDARP00000028001 snx4-003 LG_ BX255930.3 Danio rerio protein_coding KNOWN, 949 bp
GACGGTAAACCATGGCGGATTCAGGAAGCGAGGATATAGC
GGTGATTGGAAACACAGACCTGACTCCGTCGGAGTCACAG
AACAACTTAAAGAACACGATGGTTGAAAAAGGGACAAGTC
TTCTGAAGAAGATGGAAATCAGTGTGGCTGAAGCAGAGAA
GAGGACCGGGAAGAATGCAGTCAACATGCAGGAGACTTAT
ACAGTGTATCTTATAGAGACGAGACCGGTGGATGCTGCAT
CAGAAGGGACCAGTCCTGTCCCAGATTCTCTCTGGAGGCG
TTACAGCGAGTTTGAGCTCCTTAGAAACTATTTGTTAGTC
ACTTATCCGTTTGTGGTGGTTCCACCTTTGCCTGAAAAAC
GGGCGGAATTTGTTTGGCACAAGCTTTCGGCAGACAACAT
GGACCCTGACTTTGTGGAGAGGCGTCGAGTTGGACTAGAG
AACTTCCTGCTGCGAGTGGCTTCACATCCAGTCCTGGCCA
GGGACAATATCTTCTATTTGTTTCTCACTGAGGAAAAAGC
TTGGAAGGAAACCGTATTCGAGACAGGATTTCAGGCGAAG
GCCGACTCCAGAATAAAGGCGTTAAATGCCACGTTCAGAG
TAAAGAATCCTGACAAGAGGTTTGCAGAAATGAAACACTA
TGGAGATGAGCTGCAGGCTGTTGTTTCACAGCTGCTGAGA
GTTCGGGCGAGAGCAGCTGATCGCTTTTATGGTGTCTACA
AAGTCCATGGAAACTATGGAAGAGTTTTTAGCGAGTGGAG
CGCCATTGAGAAAGAGATGGGAGATGGGCTGCAGAGCGCC
GGACACCACATGGATGCGTGTCTCCAACAACAGGCTGATA
TGCACGCAAGGTATGCTGCCTCTATAGATGATATTCTAGA
AGAAGAGGAGCATTATGCAGACCAGCTGAAGGAGTATCTT
TTCTACGCAGATGCATTGCGGGCAGTGTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations