Transcript

snx4-201

ID
ZDB-TSCRIPT-090929-9062
Name
snx4-201
Previous Names
  • snx4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026385 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026385|OTTDARG00000020922|ZDB-GENE-030131-1923 snx4|OTTDARP00000021651 snx4-001 LG_ BX255930.3 Danio rerio protein_coding KNOWN, 2518 bp
AGCGCGGGACGGTAAACCATGGCGGATTCAGGAAGCGAGG
ATATAGCGGTGATTGGAAACACAGACCTGACTCCGTCGGA
GTCACAGAACAACTTAAAGAACACGATGGTTGAAAAAGGG
ACAAGTCTTCTGAAGAAGATGGAAATCAGTGTGGCTGAAG
CAGAGAAGAGGACCGGGAAGAATGCAGTCAACATGCAGGA
GACTTATACAGTGTATCTTATAGAGACGAGACCGGTGGAT
GCTGCATCAGAAGGGACCAGTCCTGTCCCAGATTCTCTCT
GGAGGCGTTACAGCGAGTTTGAGCTCCTTAGAAACTATTT
GTTAGTCACTTATCCGTTTGTGGTGGTTCCACCTTTGCCT
GAAAAACGGGCGGAATTTGTTTGGCACAAGCTTTCGGCAG
ACAACATGGACCCTGACTTTGTGGAGAGGCGTCGAGTTGG
ACTAGAGAACTTCCTGCTGCGAGTGGCTTCACATCCAGTC
CTGGCCAGGGACAATATCTTCTATTTGTTTCTCACTGAGG
AAAAAGCTTGGAAGGAAACCGTATTCGAGACAGGATTTCA
GGCGAAGGCCGACTCCAGAATAAAGGCGTTAAATGCCACG
TTCAGAGTAAAGAATCCTGACAAGAGGTTTGCAGAAATGA
AACACTATGGAGATGAGCTGCAGGCTGTTGTTTCACAGCT
GCTGAGAGTTCGGGCGAGAGCAGCTGATCGCTTTTATGGT
GTCTACAAAGTCCATGGAAACTATGGAAGAGTTTTTAGCG
AGTGGAGCGCCATTGAGAAAGAGATGGGAGATGGGCTGCA
GAGCGCCGGACACCACATGGATGCGTATGCTGCCTCTATA
GATGATATTCTAGAAGAAGAGGAGCATTATGCAGACCAGC
TGAAGGAGTATCTTTTCTACGCAGATGCATTGCGGGCAGT
GTGTAGGAAGCATGAACTGACTCAGTATGAACTGGAGACA
GCCGTCCAGGATCTGAGCTCTAAGAAACAGCAGCGGGAGG
AACTCGCCACCGGGACGGTCCGGACCTTCTCTCTGAAGGG
AATGACCAGTAAACTGTTTGGACAAGAGACCCCAGAGCAG
AGAGAGGCCAAGCTGAAAATGCTGGAGACACAGATTGAAG
AAGGAGAGGAAATGGTCAAAGACAGAAATGTAGAATGCGA
AGAGTTTGTGAAAGGTGCATGGACGGACATTGAGAGGTTC
AAAGAGCAGAAAGACCATGATCTCCGAGAAGCTCTCATCA
GCTACGCCATCATGCAGATCAGCATGTGTAAAAAGGGAAT
TCAAGTGTGGAACAACGCTAAAGAGTGCTTCAGTAAGATG
TAAGTGTTCGAGCAGGACAACCAGAACACCAGGGAGGCCT
TGGAGATGTCAATCCAGAGAAGCACACACTCCTAGAGACT
GACCATGGGGACTAAAGTCTTCCTCTCTATCTTAAACTTT
TGTCAGCCTCTTGCACCAGATGCTCTGGTGAATAAAAGGT
ATCGAATATTGACATACACTAGTTTCAGAGTCCAAATAAT
GAATAAATGGGGTGCTGTTTTATTTATTTCCATGTTTACC
AGATAGATTTCTGATCTGGTTACTTTTGTGAATGCACTAT
TCTGACCTACACAAGAGCTTGTGCAGATAACAGACAATTA
ATGACTTAACGCTTCAGACAATACAATGACTTATTATTGA
TTAATCTGGAACTATGTAATGATTTTTGTATGATTTGTTG
TCTTTTTCTTTGCCTATCTTCATGCTTTTTGATGCCAAAA
TAATTCATTTTTATACTTTTCATTTTCTTTTTATTAAATC
TAGTCAATCATAAAACACAAAAGCACATTTAAATTGTCAA
CATAAGGGTGTGTATTTTATGAGGGGGAAAAAAGTTGTAT
TTTTATCATACCCCTCACCCCACCCCACCCCATAATGGTG
GTCCCGCACATCTGGAACGTGTCCAGTTTCTAGTTTTCAT
GCGTAATGATCTTTATCATCTGGCACGGAGGACACCAAGA
GTCAGATTTCCTATGAAAAGTAAAGTAACTGTTCTTATTC
ACATGCAAACTAAATTGGTCCTGACGCCCATACAGCAAAC
AAAGTGCATAAATTCATCATAGTTTGCTGCTCTGTCACTT
TTCTGCACGTTCAGCCATAAAAGCATAAGCTGTTTATGAC
CACCGGCCCCCTCCCTTTCTACGGTTCAGTTCATCTGAGA
AATATTAATATGCTGTTTATGCCTTATTCAAGAATAACTG
CATATTTTCTTCACTATGAATGCCATATTTGTCATGTGTT
ATGATGAATGGGTGGGGTCGATGTTTTGATATAAATCTGG
CTGAAGGAATACGAATGTCACAGGAAAGGCAGGATATTAC
AATTTCCACATTTTAGAGTAGCATGAGCAACTCAGCCTGG
TCATTGGGTTCATTTTTTGGGGGTGGAGATGATTATTTGT
ATATAAGCTGTTAAAATCATTGTTGTGTAACACTAATGGT
AATAATAATAGTAATAATAAAGTACCATTATCACTTGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations