Transcript

dusp1-002

ID
ZDB-TSCRIPT-090929-9018
Name
dusp1-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026341 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026341|OTTDARG00000020900|ZDB-GENE-040426-2018 dusp1|no_translation dusp1-002 LG_ CR381700.6 Danio rerio protein_coding KNOWN, 545 bp
ATTTCAAAACACTGACCTCTGTTTTGTTTTTTTTAGGTGG
ATTTGACACATTTTCCGCTGAGTTTCCTGAAAAGTGTACA
AAGACCGTCCCCCCACAAGGCTTGAGTTTACCTCTGAGCT
CCAACTGCCATTCAAACACCGCTGATTCCTCCTGTAACAC
ATGTACAACCCCTCTGTATGATCAGGGTGGCCCTGTAGAA
ATCCTGCCTTTCCTATATTTGGGCAGTGCTTATCACGCTT
CCAGAAAAGACATGCTGGACATGTTGGGGATCACCGCTCT
TATTAACGTCTCTTCCAACTGTCCCAACCACTTTGAAGAC
CACTACCAGTACAAAAGCATTCCAGTTGAAGACAACCACA
AGGCTAACATCAGTTCCTGGTTCAACGAGGCCATCGAATT
TATTGATTCTGTACGGAATAAAGGTGGACGTGTCTTTGTT
CACTGCCAAGCGGGAATCTCGCGCTCTGCCACCATCTGTC
TGGCTTATCTGATGCGCACCAACCGCGTCAAACTGGAAGA
GGCCTTCGAATTCGTTAAACAGCGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations