Transcript

dusp1-202

ID
ZDB-TSCRIPT-090929-9017
Name
dusp1-202
Previous Names
  • dusp1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026340 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026340|OTTDARG00000020900|ZDB-GENE-040426-2018 dusp1|OTTDARP00000021621 dusp1-001 LG_ CR381700.6 Danio rerio protein_coding KNOWN, 2326 bp
AAAGCTCAGAGAGTCGTTCACTTCAGAACAAGAAGAAAAG
CAGTAACGAGTTTAGAATTGAAAACAAAAGAACTGACATT
TCAGCGTCGCTTCACGGACTATTACAACATCAAATTCTCG
ATCACGGGACTTTGGAGAAACTTTTCAAGCGCGCTGGGTT
TGTTTCGTTCATCTAGCTGTATGTATTTAGAGCTGTCCTT
CTGTACTATGGTCATCATGGAAGTGCCCACTATCGATTCG
GCCTCACTTCGGGATATGTTGGAGGGAGACGACCCGGATT
GTTTGGTTTTGGACTGTCGCTCCTTCTTTTCTTTCAGCGT
ATCTCACATTTCGGGCTCCAGTAATGTGCGCTTCAGTACT
ATCGTGCGCCGGAGGGCCAGAGGGGGGCTGGGGCTTGAGC
ACATTGTGCCCAACGAGGACACCAGGAACAGGCTTCTGTC
CGGGGAATACCAGAGTGTCGTTTTCCTGGATGACCACAGT
CTAGAGATGGGAGAAGTGAAGAAAGACGGGACTTTAATGC
TCGCTGTGAACGCGTTGTGCCGCAAACAATGTGGAGCAAG
TGTATACCTTCTTAAAGGTGGATTTGACACATTTTCCGCT
GAGTTTCCTGAAAAGTGTACAAAGACCGTCCCCCCACAAG
GCTTGAGTTTACCTCTGAGCTCCAACTGCCATTCAAACAC
CGCTGATTCCTCCTGTAACACATGTACAACCCCTCTGTAT
GATCAGGGTGGCCCTGTAGAAATCCTGCCTTTCCTATATT
TGGGCAGTGCTTATCACGCTTCCAGAAAAGACATGCTGGA
CATGTTGGGGATCACCGCTCTTATTAACGTCTCTTCCAAC
TGTCCCAACCACTTTGAAGACCACTACCAGTACAAAAGCA
TTCCAGTTGAAGACAACCACAAGGCTAACATCAGTTCCTG
GTTCAACGAGGCCATCGAATTTATTGATTCTGTACGGAAT
AAAGGTGGACGTGTCTTTGTTCACTGCCAAGCGGGAATCT
CGCGCTCTGCCACCATCTGTCTGGCTTATCTGATGCGCAC
CAACCGCGTCAAACTGGAAGAGGCCTTCGAATTCGTTAAA
CAGCGACGCAGCATCATCTCGCCCAACTTCAGCTTCATGG
GCCAGCTTTTACAATTCGAGTCGCAAGTTCTGGCCTCCTC
TACGTGTTCCTCAGAAGCAGGAAGCCCCGCCATTGGCAAG
AACAGCACTGTGTTCAACTTCCCCGTCCACACAGCGGCCA
GTCCTCTTTCCTTCCTGCAGAGTCCCATCACTACCTCACC
CTCCTGCTGAGACACACTCTTTAAAGTGGTCAGACTCCTA
ATCTCGCCTCTCAACCGGCGAGACTTTTATTTATATGAAG
ACTGTATGATCCCTGAGGTGATCTTGCCAGTATTAAAAGC
CTCGGGAATCTTCCTGAATGTTCCTGTTGCTAACTGTTTT
CCACGATTGCTCAATTTGACGATGGCTAATGTAGCCTAGA
ACTCTGTTTTAGCATTTTTATACTGTGGTCCATATTTGAC
TTAACCTTTTAATGTGACGAATATTAAAGGGACCGTTCAC
CTGAGAATTTTACTCGGGCTTCACTCAATTCAAATCTTTG
GGTTACTATTTTTTCTGTTGAACACATAAGATATTTTGAG
CAATGTTAAATCTGTACCCATCGACTTCCATAGTAAGTTT
TCCCTACTTTGGAAGCCAATGTTTACAAGTTTTCAGCATT
TTCAAAATACGTTTTCAAAAGAAACAATAGTGAGAATTAA
ATTAAGTGAAAAATCTCTTTAAAGTAGAAACTGTCCTCCA
TTGTGTTATTATTTTGATCTTGATAATCAGTTTTGTGGTC
ATTTGTTAGCATCAAAAAAGCCCCATGTCTTATAGGTTGC
TCAGGGATTGTCGTCCTTTTTTATGTTGTTGTTTTGATTA
TGTGAGTCTGAGGAGGGAGGGAAGTCACTAGACTTGAAGG
TGCTATCAAAAAGTACTGCTACGATTTTTATTCTTAGAAC
ATTGAATGTAGTCTTTCCAGGCTCTGCCGTAAGACAGTGG
ATGTTGAAGTGTTTTATTTTGTGCAAGCCTGTCATGCCTT
TTCAAAAAGCAATCTGATTCCAGACGTTTGCTTGTCTGTA
AACAAACAGCGAAATACCTCATGTGTCTGTACTGTTGTCA
GTCCGGTAAGAGTCCTCTTCCCTTAAGCACTACTAACAGG
AATTACTCTTACAGGGCTTTTTTTGATATGTGACTATTTA
TTGACTAAATTAATATATTTCTTATGCTATATTTTTTCAT
ATATTTGTGATACTTGCTGACAAATAAACATGTTTTTTAT
ATGCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations