Transcript

sf3b1-201

ID
ZDB-TSCRIPT-090929-8735
Name
sf3b1-201
Previous Names
  • sf3b1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026040 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026040|OTTDARG00000020724|ZDB-GENE-040827-3 sf3b1|OTTDARP00000021390 sf3b1-001 LG_ BX530407.26 Danio rerio protein_coding KNOWN, 4644 bp
GAGACGCTGTCGTGAAAGGCCTTCCGGTAGTGAGGCTTAC
ACAACAGCACGAAAATGGCGCAGATCGCCAAAACACATGA
TGACATTGAGGCTCAGATCCTGGAAATCCAGGGGAAGAAA
GCCGCTCTGGTGGTGGAGGGCGGTGACCAAGGAGTTGGCC
TTGATTCCACTGGGTATTATGACCAGGAGATCTACGGGGG
CAGTGACAGCCGCTTTGATGGGTATTTGACTTCAATTGCT
GCCAATGAGCAGGAGGATGATGATGACGAGGATTCATCTA
CAAGTCTCCTTGTACAGAAGAAACCAGGATATCATGCTCC
GGTTGCAATACTCAACTCAATTCCTCAGTCAGATGAGCAG
TATGATCCCTTTGCCGAACACAGACCGCAGAAAATTTCAG
ACAGGGAGGATGAATACAAGAAGCGCAGACAAAAGATGAT
CATCTCCCCAGAGCGTCATGACCCGTTTGCTGATGGGGGT
AAAACACCGGATCCCAAGGTGCAGGTCAGGACGTACATGG
ATGTTATGAAGGAGCAGCAACTTTCCAAAGAAGAGAGAGA
GATCAGACTACAGATGGTAGAGAAAGCAAAAGCTGGAGAG
CTGAAAGCAGTGAATGGCTCCGCTGCATCTCAGGCCGCGG
CCAAACGTAAACGTCGCTGGGACCAGACTGCTGATCAAAC
CCCCAGCAACTCAACACCCAAAAAAGTGTCCAGTTGGGAC
CAAGCAGACGGAGGTTCTGAAACACCAGGACACACACCAG
GGCACACACCCTCCAACAGTCGTTGGGATGAGACCCCTGG
CCGTCCCAAAGGTAGTGAAACCCCAGGAGCCACTCCTAGC
ACTCGTATGTGGGAACCCACACCTAGCCACACCCCAGCAG
GAGCTGCCACACCAGGCCGAGACACACCTGGACATGCTAC
GCCAGGCCATGGAGGGGCCACTTCCAGTGTGCGCAAGAAC
CGCTGGGATGAGACACCAAAGACAGAGAGAGAAACACCTG
GTCATGGCAGTGGCTGGGCTGAAACCCCACGTACAGACAG
AGGAGACGAGTCGGTGGGTGAGACGCCCACTCCAGGTGCA
AGCAAGAGGAAGTCAAGATGGGATGAAACACCAGCCAGCC
AAATGGGCTCTTCAACTCCCCTGCTCACCCCTGGAAAAAC
CCCTCTGGGTACACCTGCTATGAATATGGCCACGCCCACT
CCAGGTCACCTGATGAGCATGACTCCAGAACAGCTGCAGG
CTTGGCGGTGGGAGCGGGAGATTGATGAAAGGAACCGTCC
ATTGACTGATGAGGAACTTGATGCAATGTTTCCAGAGGGA
TACAAAGTTCTGCCCCCTCCAGCAGGCTATGTGCCCATCC
GTACCCCTGCACGTAAATTAGCTGCTACTCCAACCCCTAT
TGGAGGCATGACTGGCTTCCATATGCAAACAGAAGACCGA
TCGATGAAACAAGTTAACGACCAGCCATCCGGAAACCTGC
CCTTCCTCAAGCCAGATGACATTCAGTACTTTGACAAACT
GCTGGTCGAAGTTGATGAGTCCACGCTTAGTCCAGAAGAA
CAGAAGGAGCGCAAGATCATGAAGCTGCTCCTGAAGATAA
AAAATGGAACACCTCCCATGAGAAAGGCTGCTCTTCGTCA
AATCACAGATAAGGCCAGGGAGTTTGGTGCAGGACCCCTC
TTCAACCAGATCTTGCCACTGCTAATGTCTCCTACACTGG
AGGACCAGGAGCGCCATCTCTTGGTGAAAGTCATCGATCG
TATCCTCTACAAACTTGATGATTTGGTTCGGCCATATGTG
CACAAGATTCTTGTGGTGATTGAGCCCTTGCTGATCGATG
AAGATTACTATGCTAGAGTAGAGGGAAGAGAAATCATCTC
TAATTTGGCAAAGGCTGCTGGTCTGGCCACTATGATCTCC
ACCATGAGGCCTGACATTGACAACATGGACGAGTATGTGA
GAAACACAACAGCTCGTGCTTTTGCAGTTGTGGCGTCTGC
CCTGGGCATTCCATCTCTCCTGCCTTTCCTCAAGGCTGTT
TGCAAAAGCAAGAAATCCTGGCAGGCTCGCCACACGGGTA
TTAAGATCGTCCAGCAAATCGCTATTCTCATGGGCTGTGC
TATCCTGCCACATCTTCGCAGCTTGGTGGAGATTATCGAG
CATGGTCTCGTTGATGAGCAGCAGAAAGTACGAACCATCA
GTGCTTTGGCTATTGCTGCCTTGGCTGAAGCTGCTACACC
ATACGGTATCGAGTCCTTTGATTCTGTCCTGAAACCTCTT
TGGAAGGGTATCAGGCAACACAGAGGCAAGGGTCTTGCTG
CCTTCTTGAAAGCTATTGGATACTTGATTCCTCTTATGGA
TGCTGAATACGCCAACTACTACACCAGAGAAGTGATGCTT
ATCCTCATTCGAGAGTTCCAGTCACCTGATGAAGAAATGA
AGAAGATTGTCCTTAAGGTGGTGAAGCAGTGCTGTGCCAC
AGATGGTGTGGAAGCCAATTACATTAAAACAGAGATCCTG
CCCCCCTTCTTTAAACATTTCTGGCAGCACAGAATGGCAT
TGGATAGGCGCAACTACAGACAGTTGGTAGACACTACAGT
GGAGCTGGCCAATAAAGTAGGGGCAGCTGAGATTATCTCC
CGTATCGTGGATGACTTGAAGGATGAAGCTGAGCAGTACA
GAAAAATGGTGATGGAGACCATTGAGAAAATCATGGGTAA
CCTTGGTGCCGCTGACATTGATCACAAACTGGAGGAGCAG
CTTATTGATGGTATCCTGTACGCCTTCCAGGAACAAACCA
CTGAGGACTCTGTGATGCTGAATGGTTTTGGTACGGTGGT
AAATGCTCTGGGTAAGAGAGTTAAACCGTACTTGCCTCAG
ATCTGCGGTACAGTTCTGTGGCGTCTCAACAACAAATCTG
CCAAAGTCCGTCAACAGGCTGCTGACCTGATCTCTCGCAC
AGCGGTGGTTATGAAGACATGCCAAGAGGAAAAGCTTATG
GGCCATTTGGGTGTGGTGTTGTATGAGTACCTGGGAGAAG
AATATCCTGAAGTGCTGGGTAGCATTCTTGGAGCCCTGAA
AGCCATCGTCAATGTCATTGGTATGCACAAGATGACGCCT
CCTATCAAAGACTTGCTTCCACGTTTGACTCCCATCTTGA
AGAACAGACATGAGAAGGTGCAGGAGAACTGCATTGATCT
TGTGGGCAGAATTGCTGACAGGGGTGCGGAGTACGTGTCT
GCCAGGGAATGGATGCGCATCTGTTTTGAATTGTTGGAGT
TGTTGAAAGCCCACAAGAAGGCCATCCGCAGAGCTACTGT
CAACACTTTCGGCTATATCGCCAAGGCCATTGGTCCGCAT
GATGTGCTGGCCACACTGCTCAATAATCTTAAGGTGCAGG
AGCGTCAGAACCGTGTGTGCACAACAGTAGCCATTGCTAT
TGTGGCTGAGACCTGTTCGCCATTCACCGTGCTTCCAGCG
CTGATGAACGAGTATCGTGTTCCTGAGCTTAATGTGCAGA
ATGGTGTCCTAAAGTCTCTATCCTTCCTGTTTGAATATAT
TGGTGAAATGGGCAAAGATTATATATATGCTGTCACGCCT
TTGTTGGAAGATGCTCTGATGGACAGAGATCTGGTACACA
GACAGACTGCTAGTGCTGTGGTGCAGCACATGTCTTTAGG
GGTTTATGGCTTCGGCTGTGAAGATTCTCTTAATCATTTA
CTCAACTATGTTTGGCCAAATGTCTTTGAAACGTCTCCTC
ATGTCATCCAAGCTGTAATGGGGGCTCTTGAGGGTCTGCG
AGTGGCAATTGGACCCTGCCGAATGCTGCAGTATTGCTTA
CAGGGTTTGTTTCATCCTGCTCGGAAAGTGCGTGATGTTT
ACTGGAAGATCTACAACTCCATTTATATTGGTTCCCAGGA
TGCTCTAATCGCACATTATCCTCTAATCTTCAACGATGAG
AAGAACTCGTATGTTCGTTATGAGCTGGAGTACTTTCTGT
GAATATATCTATCCTTACATGTGCACTCTCTCTTCCCTCC
TATATCTGTGTGTATTTCATGGTTTATAGGACTCGGTCCA
TTTTTTTATGTTTACTGGTAGATTGTAACCAGCACCACAG
ATTTTGTGGGTTAAAATTCATTTCTAATTAAAGAACAGGA
AAATACAGAAAAAAAGGAGTATGTCAAACATGACGCTTTT
AGATCTTTGGATTAGAGTTTTCTGTTTTTACGGTGTGGCT
CTATGCACAGTGACGGTAAAGGTAGTAGCAGAGACTCTGA
GGAGTGTGATTTATCTTCAGTACATCTTTTAACTCGACGT
GTCCTGGTCTGTCAAGTTCGCTCTTTTGCTCAGTCACACA
TCTGTTCTTACTATAATGTTGCTTAGTTCGGCTGAATAAA
CGTTTGTGTATTAAAAGTCATTGATCTTTTGTTTGATGAT
TCGTGCACTACTAAAGTCTGAATTTAAAAAAAAAAAAAAA
ACTTTGAAAATTTAGTTTGAACAATCCAAGTTTTATCACC
AACAAACGGACAGTGTAAGGATTGTCCTAACATTAATTTT
GAAAATCATTTCCTGTGTATTTTGTGCTTTATTGGAAGTT
ATTTTAGTTTCATGTACTATTAAAGCCGGTCCTATTTTGT
TTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations