Transcript

sf3b1-002

ID
ZDB-TSCRIPT-090929-15006
Name
sf3b1-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034103 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034103|OTTDARG00000020724|ZDB-GENE-040827-3 sf3b1|no_translation sf3b1-002 LG_ BX530407.26 Danio rerio protein_coding KNOWN, 649 bp
ACATTGAGGCTCAGATCCTGGAAATCCAGGGGAAGAAAGC
CGCTCTGGTGGTGGAGGGCGGTGACCAAGGAGTTGGCCTT
GATTCCACTGGGTATTATGACCAGGAGATCTACGGGGGCA
GTGACAGCCGCTTTGATGGGTATTTGACTTCAATTGCTGC
CAATGAGCAGGAGGATGATGATGACGAGGATTCATCTACA
AGTCTCCTTGTACAGAAGAAACCAGGATATCATGCTCCGG
TTGCAATACTCAACTCAATTCCTCAGTCAGATGAGCAGTA
TGATCCCTTTGCCGAACACAGACCGCAGAAAATTTCAGAC
AGGGAGGATGAATACAAGAAGCGCAGACAAAAGATGATCA
TCTCCCCAGAGCGTCATGACCCGTTTGCTGATGGTAAATT
TCACACTACCATTCTCCTCTGCTTATTTTATTTGCCCATG
CCAATCAGTATTTATGTTCTCTGCCCATGACGATCCGGTG
CAGACCGGCCTTTTTTGCTGCTTAACCCTTCGAACACCAC
CCAACTGCTTGCTCCCTGGACTGATCTGTAAAGGCCCTGA
TATGTGCTCAGCGAAGTCTTTGAATTTTTCTTAAAACTTT
CATTTAAGGATAAAATAAGTGTAAAATACTTGAACAGTTC
TGTTCTGTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations