Transcript

ift88-201

ID
ZDB-TSCRIPT-090929-8393
Name
ift88-201
Previous Names
  • ift88-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025674 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025674|OTTDARG00000020500|ZDB-GENE-030131-574 ift88|OTTDARP00000021104 ift88-001 LG_ CR392366.4 Danio rerio protein_coding KNOWN, 2941 bp
TGGTGCTACAACGAAAAGCAAAACGGTAAAACCGCTCATG
TGTAGTCTATCGTTGTCCATCTTTGTATCCTAGCAACCGA
TGTGTTGCTCAGAGTCAGATTAGTTAGCAGGCTGCATCTG
CTGCTGCTGGGCCAAGGACGCGGTTTTTGGGAGTATTTCT
GTTTAATAAGGCTATCAATTATCACTTTCCTCGATGGAGA
ATGTGCATCTTGTCCCAGAGGAAGAGGAGGATGATTTGTA
TACAGGCTACAATGATTACAATCCCACTTTTGACTCAGAG
GACCTTCACAATGATGTGGCCTTCCAGCAGGCTGTCAGGA
CAAGTCATGGCAGGAGACCCCCAATGACAGCAAAATATCC
TGGCACTGCTATTGGAGGGCGACCGATTGGTACAGCTTAT
GGGTCTCGAGTGCCTATTGGCACTGCAATGGGACGGCCAA
TGACTGGAGCTGTTCAGGATGGTGCAGCTCGTCCCATGAC
TGCCGTTCGGGCCGCAGGATATTCTTCATCAATAGCTAGA
GGCTCTGCGTTTGATCCACTGGGACAGGCAAAAGGACCGG
CTCCTCCATTAGAGACAAAGAATGAAGACACTCCAGAGGA
AAAGATAAAGATCCTGGAAAAGAAGGTGAATGATTTGATA
GAGGATAGCTGTCTTGCTCATGCACGTGGAGATCTTCAGG
TGTCTCTAGAGAAAGCCAAAGAAGCAGGCAGGAAGGAAAG
AGCTTTGGTGAGACAGAGAGAACAAACAGGCACTGCAGAC
CACATCAATCTGGATCTGACATACTCTGTGCTGTTTAATT
TAGCAAATCAGTATGCCAACAATGACATGTACACCGAGGC
CTTGAACACTTACCAAGTCATTGTGAAGAACAAAATGTTC
AATAATGCAGGGCGATTAAAAGTGAACATGGCAAATATAT
ATTTCAAGCAAAAGAACTATACAAAGGCTATTAAATTTTA
TCGCATGGCTTTGGATCAGATTTCAAATGCCCACAATGCA
ATGAGGATAAAGATCATGCAGAACATTGGAGTTGTGTTCA
TACACATGGGCCAGTACTCAGACGCCATCACATCCTTTGA
GTACATCATGACTGAGAGCCCTAACATAAAGACAGGTTTC
AACCTCATCCTGTGCTACTATGCCATTGGAGACCGTGAGA
GGATGAAGAAAGCTTTTCAAAAACTCATTTGTGTGCCCCT
TGGAGTTGACGATGATGACAAGTATATCCCACCTAATGAC
GACCCTCATGCAAACATGGTGATTGAAGCTATAAAGAATG
ATAAGCTTCACCAAATGGAAAGAGAGAGGAAAGCACTTGC
TGAAAAATATATTATGACCTCAGCCAAACTCATTGCTCCA
GCAATCGAGATGTCATTTGCAGCTGGGTTTGACTGGTGTG
TGGACATGGTGAAGGGTTCCCAATACGTGGAGCTTGCAAA
TGACTTGGAGATCAATAAAGCCATTACCTACCTAAGACAG
AGAGACTTCAAACAGGCAGTTGAGACGCTAAAGATGTTTG
AGAAGAAGGACAGTCGAGTAAAAAGTGCAGCTGCCACTAA
TCTTTCTTTTCTTTATTTTTTGGAAAAAGATTTTGACCAG
GCTGACCGCTATGCAGAGCTGGCCATGAGCGCTGACCGCT
ACAACCCCGCAGCCCTCATTAACAAAGGCAACACGTTGTT
TGTGAAGGAGGACTATGAGAAAGCAGCAGAGTTTTACAAG
GAGTCTCTTCGTAATGACTCATCCTGCACTGAAGCACTCT
ACAACTTAGGTTTGACGTATAAGAGGCTGGGTAGACTGGA
GGAAGCTCTGGATTGTTTTCTCAAACTGCATGCCATCCTC
AGAAACAGTGCTCAGGTCATGTACCAGCTGGCTAATCTAT
ATGAGATGTTGGAGGACCCTCATCAGGCCATCGAGTGGCT
AATGCAGCTCACCAGTGTGACCCCTACAGATGCACAGGTG
CTGGCCAAACTCGGAGACCTCTATGACAATGAAGGAGACA
AATCTCAGGCCTTTCAGTATTATTATGAGTCGTACAGGTA
TTTTCCCTCAAACATTAGTGTCATTGAGTGGTTGGGTGCA
TATTACATCGACACCCAGTTCTGTGAGAAAGCAATTCAGT
ACTTTGAGAGAGCTACCCTAATTCAGCCAACACAGGTGAA
GTGGCAGCTTATGGTGGCCAGCTGTTACAGGAGAAGTGGG
AATTATCAGAAGGCACTTGAGACCTACAAGGAGATCCATC
GCAAATTTCCTGAAAATGTTGAATGTTTGCGATTCCTGGT
CCGGCTTTGCACAGATATGGGACTAAAAGAGGTGCAGGAC
TACGCCACCAAACTCAAGAAAGTTGAAAAAATGAAGGAGA
TCAGAGAGCAGAGGGTGAGGTCTGGAAGGGATAGCAGTGC
TCGAAGCCGCAGGGAAGGTAGCGCTGGCAGTGACAGTGGA
CAGAGCAACCATGGCACCAGCGCCAAGAGTGAGAGGCTTA
GCGTTAAACTGAAAACTCTTCCAGGATCCAATGAGCCGTA
TGAAGCCAGTACTCAACAGGAAATAGATGCTTCTTATGTC
GATCCATTGGGGCCTCAAACACAGAGGCCAAAAACTGCAG
CAAGGAAACGCAATGAGGAGGATGAGTTTGCTGATGAAGA
GCTGGGAGATGATTTACTGCCTGAGTGAGGAGAGCAGCAG
GAGTCCAGTGGAAACAATGATCCATCTTTAGAAAGTGCTT
TCGTCTTCATTGTCAGCTTAAACAACAGTACGGTAGCTTA
AAAAATACTTTCATTTCAATATGCTGAACTATATTTGATC
AGAGAAGGCATTATCTTTATATAATTCTATTTAAGAAATA
CACTACTCATCCTGAATTATTTATTTCATCTGTTAGTTGT
ATTGTAAAGATATAAACCTTTGTATGACTGAATTGTGAAA
TATTAAAAAGAATGGTTGTAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations