Transcript

ift88-203

ID
ZDB-TSCRIPT-090929-16632
Name
ift88-203
Previous Names
  • ift88-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036092 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036092|OTTDARG00000020500|ZDB-GENE-030131-574 ift88|OTTDARP00000028960 ift88-002 LG_ CR392366.4 Danio rerio protein_coding KNOWN, 602 bp
GGAGCAGTTCGAGCCCCATCAATACCCCTCCTCTGAGAGC
CAGTGTTTCTCGCTCTGAAGTTAAGTATAGTCCTGTGCTG
GAGCAGAGCAGAGACAGTGGACAGAGCAACCATGGCACCA
GCGCCAAGAGTGAGAGGCTTAGCGTTAAACTGAAAACTCT
TCCAGGATCCAATGAGCCGTATGAAGCCAGTACTCAACAG
GAAATAGATGCTTCTTATGTCGATCCATTGGGGCCTCAAA
CACAGAGGCCAAAAACTGCAGCAAGGAAACGCAATGAGGA
GGATGAGTTTGCTGATGAAGAGCTGGGAGATGATTTACTG
CCTGAGTGAGGAGAGCAGCAGGAGTCCAGTGGAAACAATG
ATCCATCTTTAGAAAGTGCTTTCGTCTTCATTGTCAGCTT
AAACAACAGTACGGTAGCTTAAAAAATACTTTCATTTCAA
TATGCTGAACTATATTTGATCAGAGAAGGCATTATCTTTA
TATAATTCTATTTAAGAAATACACTACTCATCCTGAATTA
TTTATTTCATCTGTTAGTTGTATTGTAAAGATATAAACCT
TTGTATGACTGAATTGTGAAATATTAAAAAGAATGGTTGT
AG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations