ZFIN ID: ZDB-TSCRIPT-090929-8389
Transcript Name: cox17-202
Previous Name: cox17-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025670 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025670|OTTDARG00000020498|ZDB-GENE-040912-91 cox17|OTTDARP00000021101 cox17-002 LG_ BX511129.15 Danio rerio protein_coding KNOWN, 654 bp
AAATGTTTTATTATTAAATCTCACCTGATAGCAGGCGTGA
TTATCTGTGTTACCAGCGCCTAAATACATAATGTGTTGAA
CGCGAGTGTTGAAGCTGTAAATATAATATTATCAATATAA
GGAACTGTTGAAGATGATGTAACTATCAATATGGTGGTCA
GCTGCAGGTTGTTCGCAGTAGTTTAGAGCTGATTAATCGG
CTGTCTTGTTATTCTCCTACAGTTTTATCGAGTGGAAATG
TCGAGTCTGTCAGCAGCGAGTGTGGAGGCTTCACCTGCAG
CGATAGAGGGAGCAGAGCAGAAAAAGCCACTCAAACCCTG
CTGTGCCTGTCCCGAGACCAAGAAAGAAAGAGATGCTTGC
ATCATTGAAAAGGGGGAGGAAAGCTGCACACACCTCATCG
AGGCACACAAGGAATGCATGAGAGCGCTTGGTTTTAACAT
ATAACACCACTATCATCATCATCATGAGTGAATGTGTGTG
ACTGCTTGCGTGGAACGGGACCCGGTGTGCTCTATTTATA
CTTTTACACTTCAGGGAAGATTATATGAAGCTGAATTTTT
TCTTCTGAGGGATATGTGTGTGTTTTCTTTTTCTTGCTTT
CACGTGTGATTTATGTATGTTTATGGTCAATAAAGATCCT
ATGCAAGATGTCAA

cox17 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cox17-201 (1)    Ensembl 497
cox17-202 654
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cox17-202 Contained in:
[BAC] RP71-68N21 (1)

Genome Resources: Vega_Trans:OTTDART00000025670 (1),  Ensembl_Trans:ENSDART00000146764 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH549949 (1) 689 bp
GenBank:EH448334 (1) 531 bp
GenBank:BQ264277 (1) 508 bp
CITATIONS (2)