header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8388
Transcript Name: cox17-201
Previous Name: cox17-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025669 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025669|OTTDARG00000020498|ZDB-GENE-040912-91 cox17|OTTDARP00000021100 cox17-001 LG_ BX511129.15 Danio rerio protein_coding KNOWN, 497 bp
CAGCAGCAGCAGGTTGTGTAAGGAAGGACGCACGTGAGCA
CATCAGTCTCTATCCATCATATAACTTTTATCGAGTGGAA
ATGTCGAGTCTGTCAGCAGCGAGTGTGGAGGCTTCACCTG
CAGCGATAGAGGGAGCAGAGCAGAAAAAGCCACTCAAACC
CTGCTGTGCCTGTCCCGAGACCAAGAAAGAAAGAGATGCT
TGCATCATTGAAAAGGGGGAGGAAAGCTGCACACACCTCA
TCGAGGCACACAAGGAATGCATGAGAGCGCTTGGTTTTAA
CATATAACACCACTATCATCATCATCATGAGTGAATGTGT
GTGACTGCTTGCGTGGAACGGGACCCGGTGTGCTCTATTT
ATACTTTTACACTTCAGGGAAGATTATATGAAGCTGAATT
TTTTCTTCTGAGGGATATGTGTGTGTTTTCTTTTTCTTGC
TTTCACGTGTGATTTATGTATGTTTATGGTCAATAAAGAT
CCTATGCAAGATGTCAA

cox17 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cox17-201 497
cox17-202 (1)    Ensembl 654
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cox17-201 Contained in:
[BAC] RP71-68N21 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000025669 (1),  Ensembl_Trans:ENSDART00000102143 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC081527 (1) 519 bp
GenBank:BI845406 (1) 501 bp
GenBank:BI864830 (1) 425 bp
CITATIONS (2)