Transcript

ythdf1-002

ID
ZDB-TSCRIPT-090929-7918
Name
ythdf1-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025154 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025154|OTTDARG00000020199|ZDB-GENE-040426-2786 ythdf1|no_translation CH211-196C10.1-002 LG_none BX649575.18,CR759927.12 Danio rerio protein_coding KNOWN, 557 bp
AGTATTGAGCTCCAGTGTGTTATAAATGGGGTTGTTTTTT
ACTATAATGTTTTGAAATCAACTTTTTCTAGTTGTTTTTA
AATAATAAACAAATAAATGAGCAAATTGAATGTAAAATGG
TTTGACATATTTAACTTCGGCCTCCAACGCTCAATCAAGT
TTCATTTTTGGCCCTTTATATGAAAAAGTTTGGGCAGCCC
TAGTCTATAGTACTGTGATCAGGCAGAACCTTTTTTTAAA
TGAGTGTTATGTAATTGTACAAAATTTGTTGAAGATCTAA
AATGTCACTAGCATAGCATTGTTTCATTCTTTCAAGATAT
AGCTTAAAGGCTTTTGGATGTAGTTTGGGCTTTGGGTTTA
ATATCAGATCTAGTCATTAGAGGTACATCTGATTTAAAAT
GTTCATTCTTTATTTCAGTGCAAAATGGCTCTCTTCATCA
GAAGGAAACGGTCCACGACAATGACTTTGAACCATACCTC
ACTGGCCAGTCTAATCCGAATAACAGTTACCAATCCATGA
CCGACCCATACCTGTCTAGCTACTACGCCCCCTCAAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations