Transcript

ythdf1-201

ID
ZDB-TSCRIPT-090929-7917
Name
ythdf1-201
Previous Names
  • ythdf1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025153 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025153|OTTDARG00000020199|ZDB-GENE-040426-2786 ythdf1|OTTDARP00000020706 CH211-196C10.1-001 LG_none BX649575.18,CR759927.12 Danio rerio protein_coding KNOWN, 4168 bp
TCCGCATGGCCACCCGGTCCATGTGGCGTCAGTCCCTCCG
CGCAGATCCCGGATGGAGCGGCCATTGGGCGGAAGTGAAC
AGAGGTGCACAATAACTGCGGGCTGGGAGGAGGAAAAATA
ATATATACACTTTGAAATAAATTTACACACGGCGTGTGAC
AGCATTGGATTTAACTCCCGAAACCGCTGAGCCTCAGATT
CTCTCGGAAACGTCCTCAGGCTGGACTTTTAACGCGCTCG
AGAGGACCTGATCGCCGGAATCAAGTCGTGGAACTTGCTG
AAAAAAGCGCAGTTGAGCCTGCACGGAGCCGAAAGGAACC
CACGGGCTTCGGGTTACGCCGAGCACCCTCGCTGCTGCTT
CTTTTTTCTTTGCAAGACTCTTGCCGAATCTAAAGAGGGC
CTCTTGATGAATTATGTCTACCACCAGTATTGACCCACAG
ACATCAAAAGGGCAAGACGCTAAAGTGCAAAATGGCTCTC
TTCATCAGAAGGAAACGGTCCACGACAATGACTTTGAACC
ATACCTCACTGGCCAGTCTAATCCGAATAACAGTTACCAA
TCCATGACCGACCCATACCTGTCTAGCTACTACGCCCCCT
CAATTGGGTTCCCGTACCCCCTCAGCGAGGCTCCCTGGTC
CACAGGTGGAGACCCGCCGATCCCATACCTCACTCCGTAT
GCCCCCCTCAGCAATGGAGACCATCACTTCATGCATGACA
CTGTGTTTGGACAGCCGGGGGGTCTGGGCAGTAGCATTTA
TCCACACCGCTTTAACTTTTTCCCCGAAAACCCTGCGTTT
TCTGCCTGGGGTACGAGTGGCTCCCAGGGCCAGCAGACTC
AGAGTTCTGCATATGGGGGCAGCTACAGTTACCCGCCCAG
TTCTTTAGGTGGAACCCTGGTGCCAGACGGGCAAACAGGC
TTCCCTAGTGACACCCTGAATAAGGCACCAGGTATGAATA
GCTTGGAGCAGGGCATGGTGGGGCTGAAGATCGGTGGTGA
TGTGACTGGAGGTGGTTCCGGAGTTAAGACGGTGGGCTCC
GTGATTGGAGGAGGGCCGGTGGCTGCGGCGGTGGCCACGG
GTAATGGTGGGACTCCTATTGGACTGCCGCCCCCTAAGCC
CACATCTTGGGCAGCCATTGCTAGCAAACCGGCCAAGCCT
CAGCAACTGAAGGTGAAGAGTAAGCCAGGGATGCCCATGG
CTGGAGGCACCCTGCCTCCGCCGCCCATCAAACACAACAT
GGACATTGGCACTTGGGATAATAAGGGGCCTGTGACCAAA
GTGGCATCATCATTGCCACCTCACCACCACCACCAGCAGC
AGCCTCCCCTCCACTCCCAGGGTCACCTTCCACCTCACCC
TCATGGACTGCCACCCCCACCTCAGCCCCCAATGCCGTCT
GCACAATCACTTGCCCAGCAGATGGCCATGCAGGGCCCAC
CCCCTCCGCAGCCTTACCAGAACCACGCCCCTGCTCCTCC
CCCGCAAACTCGGTGGGTTGCCCCACGCAATCGCAACCCT
GGTTATGGTGGTGGAGGAAGCGTGGACAGCAGTGGCTCCT
CGAGTGGTGGAGGGGTCGGCAATGGAGGCGGAGGTGGCCC
ACCGGGCTCCGGCGCCATCGAGTCCCATCCCGTCTTAGAA
AAGCTGCGTGCGGCACACAGCTACAACCCCAAGGAGTTCG
ATTGGAACCTGAAAAATGGCCGGGTGTTCATCATTAAGAG
CTACTCTGAGGACGACATCCATCGCTCCATCAAGTACTCC
ATCTGGTGCAGCACGGAACATGGAAACAAGCGGCTGGATT
CTGCGTTTCGTGCCATCAACGGCAAAGGTCCTGTCTACCT
GCTGTTCAGCGTCAACGGCAGCGGACACTTCTGTGGCGTG
GCGGAGATGCGTTCGCCTGTTGACTACGGCACCAGTGCCG
GTGTTTGGGCGCAGGACAAGTGGAAGGGCAAATTTGATGT
GGACTGGCTGTTTGTTAAAGACGTGCCCAACAGTCAGCTC
AGGCACATCCGCCTGGAGAACAATGACAACAAGCCCGTGA
CCAACTCGCGTGACACACAGGAGGTGCCTCTGGAAAAGGC
CAAGCAGGTGCTGAAGATCATCGCTACCTACAAACACACA
ACCTCCATCTTCGATGACTTCTCACATTACGAGAAACGGC
AGGAGGAGGAAGAGGTGGTAAGAAAGAATCTTGAGCCTGC
TCCTATCCAGAACCGATCCCGACTGGATCAAGAACGCCAG
AACCGAAATAAACAATAGAAGGCTGCCCCCTCCCCACAGC
TGATGAGCAGTTGTTTTAGGACTGACCATTTAAAAAATGA
AATTTAAAGAGGACACAAGATGAAATTTAAAAACAAAAAA
TAAACAATCATTATGTTTTTCTATTTAATTCTGGTGACTT
CAGCCAGCGTCAGACTCGAGCCTCTGCGCCTCCGGCTTCA
CCTCTGAGGGCTGAAGTCGATTAGCACCTCTTAACGTCGC
GTCATCATTTCGATTGATTTTTTTGTTTGTTTGTTTGTTT
TTGTTTTTTAATTATTATTTTGTTCTTTTTTTCTTCTTTT
CTATCATTTGGTATTGTTTCCATACACCTCCCTACCCTGT
TTGACCAACCAATACCTGCACAAGTCTTTTCTTTTCATCC
TATATTATTGTTTCTTCAGCCCCACTGCTCCTTAACGTGC
CCTTCAAAGTGGGTTAAATGAGTGGGTCATGACTTCTGTG
TGTGTGCGTGTATGTATGTGTGTATTAGGGAAGATGGTGG
AGTGTATGTCAGTCATGTGATTTTGAGGGGTGTGTCCAGC
AGGAGGGGCATCTCCAGCATCAGTAACTGTAACAGGCCAG
TTTTACGTTCTGTAGATCCAGAGTGGTTCGAACCCATTTA
TGGAGAATAATGCAAATGCATAGAAGGGACAATGAAATGT
GTCTTGAGATGATGTTATAAAAAAAAAGAAACTATATTTT
TGAATTATGTAACACTTGACTTGTTTTGTTCAGTGACGAG
CCACTTATGTCACACTTTTTGTTTTGTTTTCTCCTTTGTT
TTTCCTGCTTGGAGCCTTAACATTTTAAAGCTATGGAAAC
CGTTTAATAATGGCTGTTCTATACCTCAATTGAAACAGCA
TTATCAGGGAGACGACATCCCATGCATCCTTAACCAAGGG
ACGTCAACATTGTCACTGGCTGGACTAAACAAACAAAAAA
AAAAAACAACACAAAAATAAATTAACTAACTTTTTCGTTA
TGGTTCAGAGCACAGTGCTCAAGCTTTGTTTTCATACATG
CGTAATGTTTAAAGAGCAGAAATGTAACTACTTACTGTTC
CAACCCCGCCCAGCAGAGGTCGCTGTTTCTTTAAGCCAAT
CTGAGAGATGTAGCAATTCACTGCTTTTTATTTCAAATCA
CTTTAGATGCATCACCCTTATCTTTGTTTTGTTTCTCGTC
CTTTAACAGATTTGATTTCATCCCCTTTTTCCTCCCCCCT
GTCCTCAGTATATTGCTAAGCTTTAACGTAGGATCATATA
ATTATAACAATAACGAAGAACGCCTCAAAACGTGTAACCT
GAAAATTAATGTTACTGATTTACTGTTAAAAGTAAGAAAA
AACAAACAAACAACAAAAAAAAAGAGTATATGGTTTCTGT
GCGTGATTTTTTTAGGACCTGCTTGCTGTTTTGTGTGTTT
GTGTGTGGGAGAGCGGAATTGAGGGTTTAAGATTTCTATA
GTCATATAACAAAAGATTCATGAAAATATATGAAATACTA
AAAATATTAAAAAAAGAGTTACAAGACGAACATTTAAGTC
ACCCCTGAGATGAATATGCATTGTATTGGAAGGTCATTAT
CTATCACGTTCTTAGATTTGATCATGCTCATTATTAAAAT
AATACTATATGGTGTAATTGGTGTTTGAAGGTGTTCTTTT
TACTGCCTTGCTTTGTCTGGAGGATTCTCATGTCTGCTAA
TTCTGAATCAGTTTTTACGATTTAACTGCATAGATTTCAG
TTTACCAAAATTGATGAGCACAGGACAAATATGCTTCATT
TGATGACATGATGGACATATATTTGTTATTTGTTTGTTTT
CTGAAATTCAAACTATACACTACCGAATAAAAGTTTGGAG
TCAGCTGAATTAAAATGTTCTTAAAATAAGCTTCTCCTGC
TCACCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations