header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7771
Transcript Name: unc45b-201
Previous Name: unc45b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024993 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024993|OTTDARG00000020099|ZDB-GENE-020919-3 unc45b|OTTDARP00000020579 unc45b-001 LG_ CR847826.13 Danio rerio protein_coding KNOWN, 3821 bp
CTCTTGAAGTGCTGCTACTACTATTGAACAAACCAAACGA
CAAGAAACAACACTGAAGCACAGAACAGATTTTCTCTTAC
GACGAAGCTGAATTGACTTCAATGACGATGGGAGAAATTG
GAGATTCAGTCCAGTTAAAGGAAGAAGGCAACAAGCACTT
CCAGGCCGGAGAAATCGACCAAGCCATTGACTGCTATACC
AAAGCCATAAAGACCTGCAAGAAAGAAGACAAGAAAGCAT
TAGCTGTTATCTATAGGAACAGATCAGCCTGTTTCCTGAA
AAAGGAAAATTACAGCAATGCAGCATCAGATGCTACAAAA
GCTATTGATGTGGATGCAGCAGACATCAAGGCTCTGTACA
GAAGATGTCAAGCATTTGAGAAGCTCGGCAAACTGGACAT
GGCCTTTAAAGACGTCCAGAGGTGTGCAACCATCGAGCCG
AAAAACAAGACCTTTCTGGAGACCCTCAGGAGACTTGGAG
CTGAAATCCAACAAAAGCTGAAAACCACATTTTCAACAGA
CTCCAGAGTGCAAAACATGTTTGACATCCTATTTTCAGAC
GAACCAGATAAGGAAAAGAGAGAAAAGGCAGCCAATAACC
TGATAGTCCTTGCCAGAGAGGATGCGGGTGCAGAGAGAAT
CTTCCAGAACAACGGCGTGCCTTTACTCATGCAGCTGATC
GACACTGGAAAACCCGAGATGATTCTGGCTGCCATCCGGA
CGCTGTCAGGAATGTGCACAGGACACCGAGCCAGGGCAAC
TGCCATCATTCATTCAGTGGGAATCAGCAAACTGTGCAGC
ATCATGGCTGTGGACAATGAAGAGATTGCTCTGGCTACTG
CAAACCTCTTCCAGTGTGTCAATGACTCTCTGTCTGGAGG
AGACAAGAGAAACTACGGCAAAGAAGAGGCCCTCGTACTC
GACTCTAGTAAGGACTTGAAGGATATCCTGCTGGCCTTGT
TGGAGATGATCGCAAGCAAGAACGTTTCTGGACACGGCCG
AGACCAGGCGCTCAACCTGCTAACTAAAAATGTGCCAAGA
CAAAACAAGAAAAGCACTGATAACTCCAAGTGCCTTTTCA
CCATTGACCACGGCCTGAAGAAGATTCTGAAGGTGTGCGG
TCAAGTTCCAGATCTTCCAGATCAGCTGCCGATGACAGAA
AACACACAGCTGATTGCCAGCGTTCTCCTCAGCAAGCTGT
ATGATGACCTGCGCTGTGATCCTGAGAGGGATCAATTCAG
AGATATCTGTGATGACTATATTAAGAGCAAGTTTGACCCC
AACGACATGGACAAGAACATCCACGCCATCAACACTCTGT
CAGGTATCCTTCAGGGGCCTTTCGATCTGGGCAATGTCCT
GGCAGGTCGGCAGGGTGTAATGGAGATGATGGTGGCCCTC
TGCGGATCTGAGCGTGAAGTTGACCAACTGGTAGCAGTGG
AGGCCCTCATTCACGCCTCCACCAAAACCAGCAAAGCCTC
CTTCTTCATCAGCAACGGAGTCTCTCTGCTGAAGGAGATG
TACAAGAAGACCAAGAACGAGAAGATCAAGATCAGAGCTC
TTGTGGGTCTGTGCAAACTGGGATCCGCTGGGGGAGATGA
TTACAGCATGAGGCAGTTTGCAGAGGGTTCCACAGAGAAA
CTGGCCAAGCAGTGCAGAAAGTGGCTTTGCAATCCCACCC
TTGACGTGCGCACCAGAAAGTGGGCCATTGAAGGTTTGGC
TTACCTCACCAATGATGCTGATGTGAAAGATGATTTTGCT
GAGGATGAACCAGCCATGAGGGCCATGTTTGAACTCACCA
AGTCAAATGATAAGACCATCCTGTATGCGGTCGCCTGCAC
CCTTGTCAACTGCACCAACAGCTATGATAAGAAAGAGATC
ATCCCTGAAATGGTGCAACTGGCCAAATTCTCCAAACAAC
ACGTCCCTGAGCAACATCCAAAGGATAAGAAGGACTTCAT
TGTAAGGCGAGTGAAAAGACTATTGAAAGCTGGAGTCACG
TCAGCACTCGCTGTCATGGTCAAAGCTGATAACTCCATCC
TGACTGATCAGACCAAAGAAATGCTCGCAAGAGTGTTCCT
TGCCTTGACTGAAGATGTTAAAGATCGCGGCATAATCGTA
GCTCAAGGTGGAGGAAAGGCTTTGATCCCATTAGCCCTGG
AAGGAACTGACAAAGGAAAAATAAAAGCCAGCCATGCTCT
GGCTAAGATCGCTGCTGTATCCAATCCTGAAATCGCTTTC
CCTGGAGAGAGGATTTATGAAGTTGTGCGCCCACTGGTTT
CCTTGCTAGGCACAGATCGTGATGGAATGGAAAACTTTGA
AGCTCTGCGGGGTCTTACAAATCTTGCTGGCTTAAACGAC
AAACTTCGGGTAAAAATCCTGAAAGAAAAAGCGCTGCCAG
AAATCGAGAACTACATGTTTGAGGATCATGAACAGATCAG
ACAAGCCGCCACAGAGTGCATGTGCAATCTAGTTTGCTGC
AAGGAGGTCCAAGACAGATATCTGGAAGACGGCAACGATA
AGCTCAAGCTTCTAGTGCTTCTCTGCGGTGAGGATGAGGA
GAAGCTTCAGAGGGCAGCAGCCGGGGCTCTGGCGATGCTC
ACTGCCGCACAGAAGAAACTGGCTGTTAAGATGACTAAAG
TGACTGAGCAGTGGCTTGAGATCCTGCAGAGACTGTGCAT
CCACGATAACCCTGAGATTCAACACAGAGGTCTTGTGACG
GTGTTTAACATGCTGGATGCTGATGATCAACTAGCCAAGA
AGCTCGTTGAAAGTGACATGCTGGAAATCCTGACATATGT
GGCAAAACTAGAGGACAACCCCAAGAAGCAGAACGCTATA
GACGCAGCTCGTGCCTGCCTGTCCAAAGCCATGGATAATG
GACTTATAAAGCCCTTTTCCAACTAGACCGAAAATTGTGT
CGTTAGGTGAAGAGAGAATGGTCTGCTTTCTGGGAAAGTT
GAAACGACTGCAAACCATTTGTAATATGTTTTTTTTTTTT
TATTTGTAATGATGCGCATGGTTCCTTTTTCCAGATTGTA
TGTTTGTATGGCTGTTTGTTTGATCAATGGTTTTGGATTT
GGTATTTATATTTTATGTATTTGCACATTTACATTTTTGA
TTCATAGATTTATTTTGTTTTTTTTGAGAAGACTACTGGA
ATATTTTTTAATATTTACATGATCAATGTTTGTTTTAATG
TAATACATTCTATTGCAGGGGTGCCCAAACTCGTTCCTGG
AGGGCCTGCAAAGTTTACTTCCAACCCTAATCAGACACAC
CTGGGCTAGCTAATCAAGCTCTTAAGCTGCAGGGCCTTTC
CTCCCATAGACTTCTATTCATACGCATGCGAATGCGTCAG
ACCGGAAACGCAGGGTCATGCGTCAAGTTTTGCAGGTTGC
TGCGGTGCAAAGTTCAAGCTTGGTGAACTCTGACCTGCGA
AATCGCATCACTTGACTGCGTGAGACCAATTGAAGTTCAA
AACATGACCTCTCTGGACAGAAGTTTAAAACATGGAGCAA
TCACTCACTTTTTAAAATGTCTAATCATCTTGTTTAATTT
CGCCCCTTTTTCGCAGCGCCGCATGACAGAAAATCGCATG
CTCAAACTCTAGTGGGACTGCACCTTTACTAGGCTTTCTA
GAAACATCCGTGGAGATGTGTTGAGTCAAGTTGGAGCTAA
AATCTGCAGGACACCAGCTCTCCAGGACCGAGTTGGGGCA
CCCCCGTTCTATTGTATTGCTAAATCCAAATGAGCTGGCA
ATCTGTTAAAACATCCCAAATCAATAAATGCTATTAAGTA
ATTATTATTAGTCTATTAACA

unc45b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA unc45b-201 3821
aberrant processed transcript unc45b-202 (1) 521
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
unc45b-201 Contained in:
OTHER unc45b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024993 (1)
  • Ensembl_Trans:ENSDART00000002164 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF330001 (1) 3848bp
    GenBank:BC076400 (1) 3820bp
    GenBank:CT645618 (1) 488bp
    CITATIONS (2)