ZFIN ID: ZDB-TSCRIPT-090929-15553
Transcript Name: unc45b-202
Previous Name: unc45b-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034855 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034855|OTTDARG00000020099|ZDB-GENE-020919-3 unc45b|OTTDARP00000028057 unc45b-002 LG_ CR847826.13 Danio rerio protein_coding KNOWN, 521 bp
ACTACTATTGAACAAACCAAACGACAAGAAACAACACTGA
AGCACAGAACAGATTTTCTCTTACGACGAAGCTGAATTGA
CTTCAATGACGATGGGAGAAATTGGAGATTCAGTCCAGTT
AAAGGAAGAAGGCAACAAGCACTTCCAGGCCGGAGAAATC
GACCAAGCCATTGACTGCTATACCAAAGCCATAAAGACCT
GCAAGAAAGAAGACAAGAAAGCATTAGCTGTTATCTATAG
GAACAGATCAGCCTGTTTCCTGAAAAAGGAAAATTACAGC
AATGCAGCATCAGATGCTACAAAAGGTATGATTTTATGCT
ATTGATGTGGATGCAGCAGACATCAAGGCTCTGTACAGAA
GATGTCAAGCATTTGAGAAGCTCGGCAAACTGGACATGGC
CTTTAAAGACGTCCAGAGGTGTGCAACCATCGAGCCGAAA
AACAAGACCTTTCTGGAGACCCTCAGGAGACTTGGAGCTG
AAATCCAACAAAAGCTGAAAACCACATTTTCAACAGACTC
C

unc45b TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript unc45b-202 521
mRNA unc45b-201 (1)    Ensembl 3821
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
unc45b-202 Contained in:
[BAC] CH211-204D2 (1)

Genome Resources: Vega_Trans:OTTDART00000034855 (1),  Ensembl_Trans:ENSDART00000131171 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EB779038 (1) 522 nt
GenBank:EB783006 (1) 466 nt
CITATIONS (2)