ZFIN ID: ZDB-TSCRIPT-090929-7371
Transcript Name: hoxb7a-203
Previous Name: hoxb7a-004

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024520 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024520|OTTDARG00000019820|ZDB-GENE-000329-2 hoxb7a|OTTDARP00000020230 hoxb7a-004 LG_ BX927395.19 Danio rerio protein_coding KNOWN, 487 bp
GGCGGTGGTGTGAGAGGCGTGGGTGAATTATGTTTAGCTT
TAACAAATAACCAAAATACTGCTGCGATTGTACGTCATGT
CATCATGGTTGGATGTTTTGCTGCGTGTCCGGATGGATCC
AAGTGCTGACCGGAAAAGAGGCCGTCAGACCTATTCCCGC
TACCAAACATTAGAGCTGGAGAAAGAGTTTCACTTCAACC
GTTACCTTTCAAGACGGCGGCGTATCGAGATAGCACACGC
CCTGTGCTTAACCGAGCGCCAGATCAAAATTTGGTTTCAA
AACAGGAGAATGAAATGGAAGAAAGAGAACAAATCAACGG
ACCGCTGCTCGCCTGCTGCTGATCAAATTGGAGGCGACGA
GGAAGAAGAAGATGATGAGTAGCAACGCAAGTTGAAGACA
TAATAAGACTATACTAAAATATTATTGATTTGACTTGCTT
TAATTCGGGATACACTGAATAAAAAAGTTGATACTTACAA
TACTGTA

hoxb7a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hoxb7a-201 (1)    Ensembl 903
hoxb7a-203 487
ottdart00000001815 (1) 1337
ncRNA hoxb7a-002 (1)    Ensembl 865
hoxb7a-003 (1)    Ensembl 832
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hoxb7a-203 Contained in:
[BAC] CH211-72A16 (1)

Genome Resources: Vega_Trans:OTTDART00000024520 (1),  Ensembl_Trans:ENSDART00000145934 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT683488 (1) 510 nt
CITATIONS (2)