ZFIN ID: ZDB-TSCRIPT-090929-7369
Transcript Name: hoxb7a-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024518 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024518|OTTDARG00000019820|ZDB-GENE-000329-2 hoxb7a|no_translation hoxb7a-002 LG_ BX927395.19 Danio rerio protein_coding KNOWN, 865 bp
GACCGTGCATGGGCAAGGTTGTGAAAGTCTAGTTAGATTT
TTTTTCCTTTAAACCTGCAGCTAAAAAGATGGATATTTTA
CGAAGAAGGAAGTCTGAACGCCAGAGCTCCATTAGAGTCA
CGGGAGAGTGCAAGCCAGAGAATACACGTACAGCAGGGGT
GCTGACCGGAAAAGAGGCCGTCAGACCTATTCCCGCTACC
AAACATTAGAGCTGGAGAAAGAGTTTCACTTCAACCGTTA
CCTTTCAAGACGGCGGCGTATCGAGATAGCACACGCCCTG
TGCTTAACCGAGCGCCAGATCAAAATTTGGTTTCAAAACA
GGAGAATGAAATGGAAGAAAGAGAACAAATCAACGGACCG
CTGCTCGCCTGCTGCTGATCAAATTGGAGGCGACGAGGAA
GAAGAAGATGATGAGTAGCAACGCAAGTTGAAGACATAAT
AAGACTATACTAAAATATTATTGATTTGACTTGCTTTAAT
TCGGGATACACTGAATAAAAAAGTTGATACTTACAATACT
GTAGGCAACGTGTCTTTATCGTCTATGTAACTTATGTTAG
AGATGTTAATGTGCTAAACTATTAAATATAATACTACGAA
CTATTTTAAAACATTTTAATATAGATGTATAAACTACATT
TAAGACGTGAATACTAATACTGTATAATAGCCTAAATTCC
TTATATATAGGCACAATACTATATTATTAACATATGTTTC
ATAGCATTTGTGAATCTTGTATGTGTGACCTATTATTCGT
TCGGTCTATTATCCACTGAGATCAAACAAAGAAGGGAGCA
AGCTACTTTTAATTATTTCGAATTTTGATATACCCCTTTT
CTGTATTTTTGTGTAAATATTTGTC

hoxb7a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hoxb7a-201 (1)    Ensembl 903
hoxb7a-203 (1)    Ensembl 487
ottdart00000001815 (1) 1337
ncRNA hoxb7a-002 865
hoxb7a-003 (1)    Ensembl 832
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hoxb7a-002 Contained in:
[BAC] CH211-72A16 (1)

Genome Resources: Vega_Trans:OTTDART00000024518 (1),  Ensembl_Trans:ENSDART00000139334 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT708504 (1) 850 nt
CITATIONS (2)