Transcript

her7-002

ID
ZDB-TSCRIPT-090929-6290
Name
her7-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023079 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023079|OTTDARG00000018897|ZDB-GENE-000427-6 her7|no_translation her7-002 LG_ BX537304.14 Danio rerio protein_coding KNOWN, 542 bp
AAAGACCTCCACCTGCATACCTAACAGAAGAAAGCTTGGA
CATTTTCTGGAATCATATCCTCACTGATATCAACTATTGG
AGTACACGTGCAATGAAAATCCTGGCACAGACTGAAAAAA
TCAAAATGGACAGAAAGGTAACAACTTGTTTCCAGATGAA
TACCATTGAGACATGCACATGCTGTAATATTAACCAGTTA
AAACGTGATCTGTTGACTGACATTAGTCCTTTGCGTTTTC
TGAAGCTGTTAAAACCTCAGGTAGAAAGACGTAGAAGAGA
AAGGATGAACCGGAGTCTAGAAAACCTGAAACTTCTGCTC
CTGCAAGGCCCAGAACACAACCAACCTAATCAGAGACGAT
TAGAGAAAGCAGAGATCCTGGAATACACAGTTCTGTTCCT
GCAAAAGGCGAATAAAGCGAGTAAAGAAGAGGAGGGAGAA
GAAAAAAGCCAGTTTATGGAAGGCTTTTCTTCCTGTCTTC
AAAAAGCAGCCCGCTTTCTCTTGGAGGAAGGTGGACTGGA
AGGCTCGGTCACATCCATGCTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations