Transcript

her7-201

ID
ZDB-TSCRIPT-090929-6289
Name
her7-201
Previous Names
  • her7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023078 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023078|OTTDARG00000018897|ZDB-GENE-000427-6 her7|OTTDARP00000019226 her7-001 LG_ BX537304.14 Danio rerio protein_coding KNOWN, 1113 bp
ACTTCACATTTCACATTTGTTAACGCACCTCGATGAAAGA
CCTCCACCTGCATACCTAACAGAAGAAAGCTTGGACATTT
TCTGGAATCATATCCTCACTGATATCAACTATTGGAGTAC
ACGTGCAATGAAAATCCTGGCACAGACTGAAAAAATCAAA
ATGGACAGAAAGCTGTTAAAACCTCAGGTAGAAAGACGTA
GAAGAGAAAGGATGAACCGGAGTCTAGAAAACCTGAAACT
TCTGCTCCTGCAAGGCCCAGAACACAACCAACCTAATCAG
AGACGATTAGAGAAAGCAGAGATCCTGGAATACACAGTTC
TGTTCCTGCAAAAGGCGAATAAAGCGAGTAAAGAAGAGGA
GGGAGAAGAAAAAAGCCAGTTTATGGAAGGCTTTTCTTCC
TGTCTTCAAAAAGCAGCCCGCTTTCTCTTGGAGGAAGGTG
GACTGGAAGGCTCGGTCACATCCATGCTGTGTCAACGTCT
TGCTCACCCCACCATCAGACTGCCTGTCAGAGGTCACTCC
AGAAAGCAGCACGCAGAATCCAACCCACAGCATCATGCGC
GTCGTCCACACCACAAAAACACTGTCTCCAAAGCAGGACA
TCCATCAGCTTGCAGGAACACCAAAGAACCACAAGCGAGC
AGAGCTGCATTCAGAAGCACAGACTCCAACACAAAGCATT
CGACAGCTCAACCAACCTCCCGCCACCCAGAACCAGCCAG
CCAGACTGTCTGGAGACCTTGGCCTTAACTGAGAGAAAAG
ACATTCATTGAGAAATGGACTCAAAATGATGGGCCTTGTG
TAATCTCTTCTGAATTATATGCATAACAGATTTTCTTCTA
TTGCTTTTATCATCTGACATGACGTTGGAAGTGTAAATAG
TGTATGATAAATATTGCAATATATTTTTTACGCAGATTTC
TTCTCCCCCTTTTTTTTTTCTTCTCCTTGCATGATCTGTA
CTGGATGTATGATGATCATTTGTAATACATGACTGACGTA
TTTATCTGTTTTGCACATTTAATTTATTAATGACATTCCC
TTTCATGTTCAGATTTATACGTTGTGTGTTTTGATCAGTA
CATTCCACCATTAAAAGTGAAATATTCACCATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations