Transcript

adam28-002

ID
ZDB-TSCRIPT-090929-6139
Name
adam28-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022913 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022913|OTTDARG00000016473|ZDB-GENE-060929-532 adam28|no_translation CH211-133N22.1-002 LG_ BX666060.8 Danio rerio protein_coding NOVEL, 622 bp
GTTTGTGACCACAGACTGCAATGCAAATGTGAACCTGGAT
GGTTGCCGCCAGATTGTGACAAACCAGCAGAAAGTGAGGG
TTTGTCTAAAGGTGTGACAATAGCCATTTCTGTGATTGTG
ACCATCGTGATTGTGATACTTCTAATTGGACTGACCGTCT
TCTTATGCAAACGCAGAACAAGCACGCCACATGCATACAG
AGGCCAGCCAAGGCAGCAGAAAGTTCATGTAGTTGACATC
CCGGATCTCAGCCAACAGAGATCTGCTACACCAAATCAGA
AGCCAACTCCAGTAACTTCCTGCCACATCTCACCTAATTT
ATAACCTAAAATAAATGTAAAGAAATTACCTGATTTTTCT
TCTTCATTCTTCTTTAGGTAATCAAGCCCTCAGCACCCCC
TCCACCTCCACCCTACTCAGTGCACGCTCCACATAATGAA
TTCATGGCTGCACGACAGGCTCTTAGACCACCTCCTCCAA
GAGTGTGATATGGAGCACCTGTCAAACATCCAGAGTGTGA
CCGGCGGGCGCTGGCGTCACTCAAGATCCTACTGTGAAAA
AAGCCAAATGCTTAGCACAAAGAAATGCAACTTATAGTGT
GTAAACTATTATTGAATCAATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations