Transcript

adam28-201

ID
ZDB-TSCRIPT-090929-4587
Name
adam28-201
Previous Names
  • adam28-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019808 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019808|OTTDARG00000016473|ZDB-GENE-060929-532 adam28|OTTDARP00000016738 CH211-133N22.1-001 LG_ BX666060.8 Danio rerio protein_coding NOVEL, 2396 bp
GTTAGACCGCTCTGTAAGGTGTGGTCTATGGCCTAAACTA
GTCTCACGTCAACTATAAAACTTCACCTGACCAAAATCTC
CTGTTTCAGTTGTTCTGAACACTGACAATGGCCCAAAGAC
ATCTGATGTTGTGGATCTTCACTCTGTGTGTTTCACTGGA
TCCCTCAGTTGGTCACATTCACGAACTACATGGCAAGGTT
TATGAGATTGTACGACCAATAAGATTACATGATCTGCAAA
AAAGAGACTTACAGTCAAGACCGGATAGAGTGAAATATGC
TATGACACTGGGTGGTAGAGACATTGAAATGCATCTCCAG
AAAAACACTGGCATGCTGACTAAAGACTACAGCGAGACCT
ACTACACTGACGATGGCATGCTTGTCACAACTACACCGGC
AGATTTGGATTTATGCTACTATCATGGGAAAATATTAAAT
GACAGTGCCTCTTTGGTTAGCATGAGCACCTGTGATGGAC
TGCGAGGCTATTTCCAAACTGCAGAGCAGAGGTTTCTGAT
TGAGCCGTTGTCTGAGGATAGCGATGGCGACCATGCCGTC
TTCAAGTATGAAGATGTAAATGAAGCCACGCCAAGGGTGT
GTGGAGTCACCAACACTACTTGGGATGAGAGTGGCGATGG
AGTTCCTCCACGCATCCTCAAAACACGCTCTCGTTCCTCA
GGGCCAACTTTATTCCAGAGACAAAAATACAATGAGTTCT
TCCTTGTTGCAGACAACAGAGAGTACAAGAAACTGAACAG
CGATTTGGAGAAGCTGAGAAAGAGGATATTTGAGATCATC
AACTTCATCAATAATGTTTATAAAGAAATCAACACTTTTG
TTGCTCTGACTGGATTTGAAGTGTGGACAGATAATGATAA
GATAACAGTGTCTGCGGCTTCCGGAGCAACTTTGGACAGC
TTTACCAAGTGGAGAAACAGTGACCTCATAAAACGGCAGC
GGCACGACAATGCCCATCTCCTTACAGCAATTGACCTTGA
TGGAGCAACTGTAGGTCTGGCTTACATTGGAACCCTGTGC
GGAGGACTTTCAACTGGGATTGTTCAGGATCACAACTCTA
TGGCCACAGCAGTGGGGGCAACTATAGCACACGAGATGGG
GCACAATCTTGGCATGAACCATGACAGCAGCTCCTGCGTT
TGTTCTGACAGCTCTTGCATCATGACAGCTGCTCTCAGCT
ATTTCATCCCTCAACACTTTAGCAGCTGTAGTACTGGTGC
CTTTGTAGACTATCTGAACAACAAAGTCCCAGAATGCCTT
CTAAACAAACCCCAACCAAGAGATCTGCTTCAGCCGGCTG
TATGTGGGAATGGATTTGTGGAGATTGGAGAAGAATGCGA
CTGTGGAACAGTGCAGGAGTGTAAAAACCCATGTTGCAAT
GCAACCACCTGCAAACTGACTGTGGGCTCACAATGTGCAG
CAGGAGAATGTTGTGACAACTGTAAGATCATGTCAGCCTC
ACATGTGTGTCGTCCTAAAGCCGATGACTGTGATTTACCC
GAGTCATGCACTGGAAAATCAGCCGAGTGTCCTGAAGATG
TCTTTACAGTCAATGGAGTCCCTTGCAAGAACGGGAAAGG
CTATTGCTACAATGGCCAGTGTCCTATGAAAGAGGAGCAG
TGCATTAAAATGTGGGGATCAACTTCGGTGGTGGCTCGAG
ATAGTTGCTACAGCCAAAACACAAGAGCGGAGTACTACGC
TTACTGCAAACGCAATGGAGATAAATATATTGGATGCCAA
AAACAAGACATCATGTGTGGAAAGCTGTTTTGTGAAAGTG
GCAATGACAATCCCAATTATGGACGCTTGGTGACATTCAG
CAACTGTAAAGCCACATTTTACGGCAGTCCTGACGAGGAT
TATGGCCAAGTCGACACTGGCACCAAATGTGGAGAGGGGC
TGGTTTGTAACCAGAATGAGTGTGTTGGCCTAGAGACGGC
TTATAAAGCAACAAACTGCTCAAACAAATGCAAAGGCCAT
GGGGTTTGTGACCACAGACTGCAATGCAAATGTGAACCTG
GATGGTTGCCGCCAGATTGTGACAAACCAGCAGAAAGTGA
GGGTTTGTCTAAAGGTGTGACAATAGCCATTTCTGTGATT
GTGACCATCGTGATTGTGATACTTCTAATTGGACTGACCG
TCTTCTTATGCAAACGCAGAACAAGCACGCCACATGCATA
CAGAGGCCAGCCAAGGCAGCAGAAAGTTCATGTAGTTGAC
ATCCCGGATCTCAGCCAACAGAGATCTGCTACACCAAATC
AGAAGCCAACTCCAGTAATCAAGCCCTCAGCACCCCCTCC
ACCTCCACCCTACTCAGTGCACGCTCCACATAATGAATTC
ATGGCTGCACGACAGGTAGCACAGCTCAATATTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations