Transcript

tp53-004

ID
ZDB-TSCRIPT-090929-6118
Name
tp53-004
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022884 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022884|OTTDARG00000016232|ZDB-GENE-990415-270 tp53|no_translation tp53-004 LG_ AL928875.4 Danio rerio protein_coding KNOWN, 748 bp
TGAAACTCGTATTTCGAACTTTAGGCCCGACATCGCTTTA
AACGTTACTAAAACGTTGATGTTAACGTTAGCCGCTAAGC
CTGTTAGCTAGCTAACATTAGCTGTCGAAAATGCAAACTT
AGAGTTTCAGTATAATAGCTTTAGGTGACTTTTAGAAATC
TTATGTACAGCAATGGCGCAAAACGACAGCCAAGAGTTCG
CGGAGCTCTGGGAGAAGAATTTGATTATTCAGCCCCCAGG
TGGTGGCTCTTGCTGGGACATCATTAATGATGAGGAGTAC
TTGCCGGGATCGTTTGACCCCAATTTTTTTGAAAATGTGC
TTGAAGAACAGCCTCAGCCATCCACTCTCCCACCAACATC
CACTGTTCCGGAGACAAGCGACTATCCCGGCGATCATGGA
TTTAGGCTCAGGTTCCCGCAGTCTGGCACAGCAAAATCTG
TAACTTGCACTTATTCACCGGACCTGAATAAACTCTTCTG
TCAGCTGGCAAAAACTTGCCCCGTTCAAATGGTGGTGGAC
GTTGCCCCTCCACAGGGCTCCGTGGTTCGAGCCACTGCCA
TCTATAAGAAGTCCGAGCATGTGGCTGAAGTGGTCCGCAG
ATGCCCCCATCATGAGCGAACCCCGGATGGAGATAACTTG
GCGCCTGCTGGTCATTTGATAAGAGTGGAGGGCAATCAGC
GAGCAAATTACAGGGAAGATAACATCACTTTAAGGCATAG
TGTTTTTGTCCCATATGAAGCACCACAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations