Transcript

tp53-003

ID
ZDB-TSCRIPT-090929-6117
Name
tp53-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022883 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022883|OTTDARG00000016232|ZDB-GENE-990415-270 tp53|no_translation tp53-003 LG_ AL928875.4 Danio rerio protein_coding KNOWN, 579 bp
GCAACATCATTGGACCGCTTGTGTGTTGTATTATTGTAAC
AAACTGACGTCGATTCGATAAAAACTGCAATGGCGCAAAA
CGACAGCCAAGAGTTCGCGGAGCTCTGGGAGAAGAATTTG
ATTATTCAGCCCCCAGGTGGTGGCTCTTGCTGGGACATCA
TTAATGATGAGGAGTACTTGCCGGGATCGTTTGACCCCAA
TTTTTTTGAAAATGTGCTTGAAGAACAGCCTCAGCCATCC
ACTCTCCCACCAACATCCACTGTTCCGGAGACAAGCGACT
ATCCCGGCGATCATGGATTTAGGCTCAGGTTCCCGCAGTC
TGGCACAGCAAAATCTGTAACTTGCACTTATTCACCGGAC
CTGAATAAACTCTTCTGTCAGCTGGCAAAAACTTGCCCCG
TTCAAATGGTGGTGGACGTTGCCCCTCCACAGGGCTCCGT
GGTTCGAGCCACTGCCATCTATAAGAAGTCCGAGCATGTG
GCTGAAGTGGTCCGCAGATGCCCCCATCATGAGCGAACCC
CGGATGGAGATAACTTGGCGCCTGCTGGTCATTTGATAAG
AGTGGAGGGCAATCAGCGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations