Transcript

crfb1-201

ID
ZDB-TSCRIPT-090929-5085
Name
crfb1-201
Previous Names
  • crfb1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021397 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021397|OTTDARG00000017757|ZDB-GENE-030131-8673 crfb1|OTTDARP00000018020 crfb1-002 LG_ CR361551.8 Danio rerio protein_coding KNOWN, 2130 bp
AGTGAACCGGGTGTAGTGACGTTGAGAAAGCAGAGTCGGG
AAGTCCGCTCACGACTGAATGCTCGATTAGATATTTCTGT
TTACGTAGACTATTAGGCATGACTCGTAAATACTTTATCG
TCGATAAAATAAAAGGATTTACAGATCTGGACAATCCCTG
GTGGTGTATTGATTAGGACCTGGACATGCTGTGAAATCAC
CACGACTTCATCATTGCTAAAGTGTGACTCTGCTTTTGTT
TGTGAAATATGATTGGTTATCAAAATGAAGACATCATCAT
CATACACTGGCCGTCTTTTTCTCATTCATCTTTACTTTAC
AGTGATCTATGCAATCCCTGCTCCTGTCAACTTTACAATA
TGGTCTCACAACTTCAGACACATTTTACACTGGAATTATG
GGGTAAATTCTCCTCCACAGAGCGTTTTCAATTTACAAAG
ATTTGAAAAGGGAAAGCAAACAGAGCATTTGAACATCAGA
AATACAACTATGGATGTCTCTGAAGCATGTCAAGACATCT
ACATACCCTGCACTTTCCTTATTTGGGCATCGCTTGACAA
TATGAATTCATCAGTAATTGAAAAAAAATTCATACCGTAT
GAAGACACTATCATAGGTCCACCAGTTATATTTTTGTCTG
GCTGTGGAGACTGTTTGAATATCAGCATCTCTCTACCCAA
TGAATCAAGGAAAGACGATAAACTGCGTCGGTTTTATAAT
TCTGTGTCCTACAGTATAAGTTGGAAGAAACATGGAAACA
ATGAGGTCAGAGAGATCTTAAGATCTCAAGAACCAAGTAA
ACAGTATGTCCTGGAGAATCTTCAGCCTGGTGTTCAGTAC
TGTGTTAAAGTACTTCCACAAATCAATTCCAACCAGAACA
CTCAACCTTCTTCTTGGCAATGTGAATACACAAGCAAAGA
GGAGGCACAAAGAGTGTTATATTTTATGAGCTGGTTACTA
GGAGCGACGTTGTCAGGTTCATGTGTGATGATGTTGGCAT
GGATTCTGGTTTACACAGGATTTCTATGCAAGCCCAAGAA
CCCTCCTCTCAAATCACTGAGTAACATTGTTCCAGCCACC
TATCTGATTCCTGAACAGACGTTGTCTGAGAGTCTGTCAT
TAACTGAGGTTCAGTTAATTCATTTGTCCTATGATACTAC
CGAAAACAACAGTCAACTGAAAAATCCTGAAAAAAGGGAA
TATGAAGGCAGTGTCCTCAAGTCAGACACTGAGGATGAGG
AAGACAGTAATGATGAAGACGAAGTCAAATGTGTCTACAT
GAGTTGTGAAATTGACGACATTAGTTGTCAAAATAATAGT
ACAAAGAAGGATATAGTTTCAGCTTTGCCATTTAATAAAA
GTTCAATTGTCTGCTACACAAAGGAACCAGCCATGGAAAA
GATCCAATATGATGATCTGAAGAGTGAAAAGGAATTATTA
TCAGAGCTTTTCGAAGAGGGACATGGACATCTTGAAGTGA
CAAATACTCAGTTAAAAACTGAGGGAAATGAGAAGGGTTC
AACAAATACCCCAGGGAACATCAACCTATTTTCAGTCACT
GTGAGGACTTTTGGAGCAGAAGATGACTTGGATAAGGAAG
ATGTGTATAAACCTCTGCTACCCAAATTGTTTGTAAAAAC
AGACAAATGGACAGAAGAGCTCTTACCTGTATCTAACAAG
ATACAGATATCTATACCCATAGAGACAGGCATGAAAACAG
ATGATCTGATTCATTTGGACAGCCAAAATGATCTTGTTCA
CGTTTGCTCTTTGGCTCATAACGTAGAAACCAACCCTGAT
ACAACAATGTCTGCATATATGATGAACCATATAGGAAAAA
TGCATGATCAAAATAAGGACTTATTAGAGGAGACAAATTG
CGACACAAGCTATATAACACGGTAAATACAACAATATTTA
TTTAAAGACTTGAAACAAGTTTAAAATTTAGGCCAACTAG
AAGTTGCCAGTGGCTTTGTTATAATTAAGATCATAAGAAC
TTTGTTTTTTTTGTAATAACTTTGATTATTGTTATAAAGT
TTGTTTAGTGCCACAATCACAGAATGATCAAAAATAAATG
AAGAGGCAAAGACATTGCTCACTAATGGCACATTAAAATA
CAAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations