Community Action Needed: Please respond to the NIH RFI
Transcript

crfb1-003

ID
ZDB-TSCRIPT-090929-15948
Name
crfb1-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035295 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035295|OTTDARG00000017757|ZDB-GENE-030131-8673 crfb1|no_translation crfb1-003 LG_ CR361551.8 Danio rerio protein_coding KNOWN, 434 bp
CGATTAGATATTTCTGTTTACGTAGACTATTAGGCATGAC
TCGTAAATACTTTATCGTCGATAAAATAAAAGGATTTACA
GATCTGGACAATCCCTGGTGGTGTATTGATTAGGACCTGG
ACATGCTGTGAAATCACCACGACTTCATCATTGCTAAAGT
GTGACTCTGCTTTTGTTTGTGAAATATGATTGGTTATCAA
AATGAAGACATCATCATCATACACTGGCCGTCTTTTTCTC
ATTCATCTTTACTTTACAGTGATCTATGCAATCCCTGCTC
CTGTCAACTTTACAATATGGTCTCACAACTTCAGACACAT
TTTACACTGGAATTATGGGGTAAATTCTCCTCCACAGAGC
GTTTTCAATTTACAAAGGTATGATTCTAAAGCAGTTTTTT
ATGTTTCCTCAAATACCAACAGTGTGCACACTGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations