Community Action Needed: Please respond to the NIH RFI
Transcript

crfb1-203

ID
ZDB-TSCRIPT-090929-14946
Name
crfb1-203
Previous Names
  • crfb1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034041 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034041|OTTDARG00000017757|ZDB-GENE-030131-8673 crfb1|OTTDARP00000027482 crfb1-001 LG_ CR361551.8 Danio rerio protein_coding KNOWN, 1602 bp
ATGACTCGTAAATACTTTATCGTCGATAAAATAAAAGGAT
TTACAGGTATTTTTTAAAAAGCATTTAACGCATCTGGACA
ATCCCTGGTGGTGTATTGATTAGGACCTGGACATGCTGTG
AAATCACCACGACTTCATCATTGCTAAAGTGTGACTCTGC
TTTTGTTTGTGAAATATGATTGGTTATCAAAATGAAGACA
TCATCATCATACACTGGCCGTCTTTTTCTCATTCATCTTT
ACTTTACAGTGATCTATGCAATCCCTGCTCCTGTCAACTT
TACAATATGGTCTCACAACTTCAGACACATTTTACACTGG
AATTATGGGGTCAGAGAGATCTTAAGATCTCAAGAACCAA
GTAAACAGTATGTCCTGGAGAATCTTCAGCCTGGTGTTCA
GTACTGTGTTAAAGTACTTCCACAAATCAATTCCAACCAG
AACACTCAACCTTCTTCTTGGCAATGTGAATACACAAGCA
AAGAGGAGGCACAAAGAGTGTTATATTTTATGAGCTGGTT
ACTAGGAGCGACGTTGTCAGGTTCATGTGTGATGATGTTG
GCATGGATTCTGGTTTACACAGGATTTCTATGCAAGCCCA
AGAACCCTCCTCTCAAATCACTGAGTAACATTGTTCCAGC
CACCTATCTGATTCCTGAACAGACGTTGTCTGAGAGTCTG
TCATTAACTGAGGTTCAGTTAATTCATTTGTCCTATGATA
CTACCGAAAACAACAGTCAACTGAAAAATCCTGAAAAAAG
GGAATATGAAGGCAGTGTCCTCAAGTCAGACACTGAGGAT
GAGGAAGACAGTAATGATGAAGACGAAGTCAAATGTGTCT
ACATGAGTTGTGAAATTGACGACATTAGTTGTCAAAATAA
TAGTACAAAGAAGGATATAGTTTCAGCTTTGCCATTTAAT
AAAAGTTCAATTGTCTGCTACACAAAGGAACCAGCCATGG
AAAAGATCCAATATGATGATCTGAAGAGTGAAAAGGAATT
ATTATCAGAGCTTTTCGAAGAGGGACATGGACATCTTGAA
GTGACAAATACTCAGTTAAAAACTGAGGGAAATGAGAAGG
GTTCAACAAATACCCCAGGGAACATCAACCTATTTTCAGT
CACTGTGAGGACTTTTGGAGCAGAAGATGACTTGGATAAG
GAAGATGTGTATAAACCTCTGCTACCCAAATTGTTTGTAA
AAACAGACAAATGGACAGAAGAGCTCTTACCTGTATCTAA
CAAGATACAGATATCTATACCCATAGAGACAGGCATGAAA
ACAGATGATCTGATTCATTTGGACAGCCAAAATGATCTTG
TTCACGTTTGCTCTTTGGCTCATAACGTAGAAACCAACCC
TGATACAACAATGTCTGCATATATGATGAACCATATAGGA
AAAATGCATGATCAAAATAAGGACTTATTAGAGGAGACAA
ATTGCGACACAAGCTATATAACACGGTAAATACAACAATA
TTTATTTAAAGACTTGAAACAAGTTTAAAATTTAGGCCAA
CTAGAAGTTGCCAGTGGCTTTGTTATAATTAAGATCATAA
GAACTTTGTTTTTTTTGTAATAACTTTGATTATTGTTATA
AA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations