Transcript

sox19a-002

ID
ZDB-TSCRIPT-090929-4440
Name
sox19a-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019438 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019438|OTTDARG00000016206|ZDB-GENE-980526-102 sox19a|no_translation sox19-002 LG_ BX119902.4 Danio rerio protein_coding KNOWN, 629 bp
CTGAAAGAGTCGCAGGCAGGACGCACAGCGAGCTCAACTC
GGACCTCTTTCGCTTTTAGGTAAACTAACGTCACTTCAGA
ACTTGTTGCTTGTGTTCAGGCGTTTACAAGCACCTCTGCT
TTTAGTTACAGACGGCTCGCTCTCGTTTTGGACGCACGTG
TTCGCGAAACGTTTAGCGTCAGTGGATTTGATTTTAAGCT
CTTTTCTAGTTTTACGGTGATACTCCGGTATCACCACTAA
CTTCTGTTGGCAGCCATGTACAGCATGCTGGAGCACGACA
TGAAGTCCGCCGTGCCACCGACGCACCAGAGCGCGCAGGG
AATGACCCAGCTGAACGGTGGAGTGACCCACGGATCCGCC
AAACCGGCTGTCAACAGCCAACAACAGCAGAGTAGCGATC
CTATGGACAAAGTTAAGAGGCCCATGAACGCATTTATGGT
GTGGTCTCGGGGTCAGAGGCGCAAAATGGCACAGGAGAAC
CCCAAAATGCACAACTCCAAGGCAGCTGGACTTCTGGCCT
TGTTGAAGTGCCTCAGAATATATTGTGTGGAATGTGTGTC
ACCCCTTTCTATCAGTTTTTTTTAAGGTCCATGTCTTTGT
TTCTGTTTAGCATTCAATGATTTTGTCAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations