Transcript

sox19a-201

ID
ZDB-TSCRIPT-090929-4439
Name
sox19a-201
Previous Names
  • sox19a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019437 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019437|OTTDARG00000016206|ZDB-GENE-980526-102 sox19a|OTTDARP00000016444 sox19-001 LG_ BX119902.4 Danio rerio protein_coding KNOWN, 2170 bp
AACCACTGAAAGAGTCGCAGGCAGGACGCACAGCGAGCTC
AACTCGGACCTCTTTCGCTTTTAGGTAAACTAACGTCACT
TCAGAACTTGTTGCTTGTGTTCAGGCGTTTACAAGCACCT
CTGCTTTTAGTTACAGACGGCTCGCTCTCGTTTTGGACGC
ACGTGTTCGCGAAACGTTTAGCGTCAGTGGATTTGATTTT
AAGCTCTTTTCTAGTTTTACGGTGATACTCCGGTATCACC
ACTAACTTCTGTTGGCAGCCATGTACAGCATGCTGGAGCA
CGACATGAAGTCCGCCGTGCCACCGACGCACCAGAGCGCG
CAGGGAATGACCCAGCTGAACGGTGGAGTGACCCACGGAT
CCGCCAAACCGGCTGTCAACAGCCAACAACAGCAGAGTAG
CGATCCTATGGACAAAGTTAAGAGGCCCATGAACGCATTT
ATGGTGTGGTCTCGGGGTCAGAGGCGCAAAATGGCACAGG
AGAACCCCAAAATGCACAACTCTGAAATCAGCAAGCGCCT
GGGCGCCGAGTGGAAGCTGTTGACGGACGCGGAGAAACGA
CCCTTTATTGATGAAGCCAAGCGGCTTCGCGCGCTGCACA
TGAAGGAGTACCCAGATTACAAATACAAACCCCGTCGTAA
GACGAAGCCCGTGCTGAAAAAGGACAACCCGGCTGCTAAG
TATCCTCTGTCAGCCGGTAACTTACTGGCGGCTGCCGCGG
CTCAGGGGTCAGGTGGAAGCCCGAGGATGGACAGCTACGG
CTGGGGTCACACCGGTGGTTACCCTGGCATGCAGACCGAT
GCGCTGGGTTACAGTCAGCAGCTGCACCGCTACGATCTGT
CCGCCCTGCAGTATCCATCCGCCATGGCCACCGCACAGAC
CTACATGAATGGTGCCAACTCCTACAACCCCATGTCCTAT
AGCAGCACTCCACAGCAGCCCAGCCCAGTCATGTCCATGG
TGAAACCAGAGCAGGTGTCTCATTCTCCCACTGGAGCCCA
CAGCCACCAGCGGGGTCCTTTACAAGGAGACCTGAGGGAC
ATGATTAGCATGTATATCCCTGGAGGAGACACCACAGACA
GTGGAGCACAAAGAGGCTACTCCAACATTCAACAGCATTA
CCTCACCGGTACGGCGCCTCTCACACACATCTGATCAGGA
AACTTTCTTTACCTTCCTGTTTCGGGTCTGGAGAGCCACC
GATGTCGGGTGAAGATGCGTGAACATTAACTTGATGCTGT
AAAAAAGGATGAGGGTGTGTGGACACATGGTTGAACTGGA
AAACCCAAGGCAGCTGGACTTCTGGCCTTGTTGAAGTGCC
TCAGAATATATTGTGTGGAATGTGTGTCACCCCTTTCTAT
CAGTTTTTTTTAAGGTCCATGTCTTTGTTTCTGTTTAGCA
TTCAATGATTTTGTCATTGAGGCCCGGTGCACTGTTGGAA
CTGCTTGTAGTAGTGAAGTGACACTTTTTCTGTAATAAAC
TAGCCGTTGGGTTGAGCCAACCAGTTGACTGGTTGAACAG
CTTATTATTTGCATGGTAAACCAGCTAGTTTAATATCTCA
CTGATTTCAAAGGCATGGCTGTGAACGCTATAAAGGTAAA
GAAGGGAATGAAGCACACATTCCCTCAGTCGCTGCTTGTC
CTGATGATCTAAACACCTCAAAATGAATCTCCCAACCTTT
AAGCTTTCGTACCATAAGACTCTGTAACATTGTGCTGCTC
TTCATTGTTTAGGTAAATGCAAAATTGAAATGCACAACGG
TTTAGACATTTTTGTTAGTGTAGGTTCATGTATGCCATGA
GGTTCAACAGATTTTTGTTGCATTAAAAGTAAAAAATAAA
ATAGAGATCCCGCTTAGAGGGATTTGACTGTATTTTCTAT
TAAAAAAAGATCCATTAATTCTCAACTGCTCTGAGAAATA
GAACATTGTGAATAGAAGAGTTGTGTAAAAAGGGGAGTCA
AAACGTTTTAAATAATGTTCATTAAAAAAAGAAACCTTTA
TGAGCTTGTTAAAAGACTGTTTGACTAAGAATGTATTGTT
GTGAAATGTTTTTTTATTATTATTTTACTTTTACGCCCTT
ATAGTAAGGGTTAATAATCTTGTTTGTGACTTGACAACCT
TGACAGAAAAACCACAAAAAAATGTAATAAAGTATTTTAT
TATTTTTGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations