ZFIN ID: ZDB-TSCRIPT-090929-4047
Transcript Name: abcf1-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000018341 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000018341|OTTDARG00000015317|ZDB-GENE-050517-31 abcf1|no_translation CH211-215A10.2-003 LG_ BX510301.6 Danio rerio protein_coding NOVEL, 663 bp
TTTTTTAAAAATTATTGCTTTTGTTTTATTTCACATTAAA
AACATAATAATAAAATAAAGTTTTAATTTTTATTTAAAAA
AACACTACAAAAAGTATGAAACGATAAATGGTATTGACAA
AAGTAGTAATATCGTTAAAACCTTAACGATACCCATCACT
AGTCATTAATGTCCTATTAAAGATGAGGAATGAAGATAAC
TAAGTTGAGTGGTTTAACATGTTCTTCATATTTCTTCATG
TTGATGTACAGGATGAGCCCACAAATAACTTGGACATTGA
GTCAATTGATGCGTTGTCAGAAGCCATCAATGAATATAAA
GGAGCTGTGATAATTGTGAGCCATGATGCCAGGCTGATCA
CAGAGACCCAGTGCCAGCTGTGGGTGGTGGAGGACCAGTC
AATCAACCAGATCGACGGAGACTTTGAAGACTACAAGAGA
GAAGTGCTGGAGGCCCTTGGTGAGACCCTGGTCAACAAGC
CTAAAGAGTGAAGCACGGCCGGTGTTTATTACAGGAGTGT
CAAACTACATCACTGAAGGGCTTTTTGCTGCGTCTACATT
GCTACTTCTCAATAGAACCAAAAAGTACCTGCATGCAAAC
ATACAAACCCTACAGCTGCAGGACGAGTGAAAGCTGACGC
CAGATCAGTATTTTCACATGCAG

abcf1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA abcf1-201 (1)    Ensembl 3347
abcf1-202 (1)    Ensembl 821
ncRNA abcf1-003 663
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
abcf1-003 Contained in:
[BAC] CH211-215A10 (1)

Genome Resources: Vega_Trans:OTTDART00000018341 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BU744228 (1) 663 bp
CITATIONS (1)