header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4045
Transcript Name: abcf1-201
Previous Name: abcf1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000018339 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000018339|OTTDARG00000015317|ZDB-GENE-050517-31 abcf1|OTTDARP00000015481 CH211-215A10.2-001 LG_ BX510301.6 Danio rerio protein_coding NOVEL, 3347 bp
GCCGCATGTGCTGTGAACTGAGCTCCAGTGTGCTCGTGTT
CATTGTCAGCTGTAAAACATCCCGCAGTCTCCTTTAACAC
ATTGGCTTTTCATTCTTAGCAAAAGAAAAGGTTAAAAGAA
AGATGCCTAAGAAGTCAAAAGAAAAGGCTGAGTGGGAGGG
TGATGATGAACCACAAACAGTAGACAAACATGTCAAAAAA
GGCAAGAAGGATAAGAAAGACAAGAAGAGTTTTTTTGAGG
AGCTGGCATCAGAGAATAAACCAGAAAAAGAACAGCCACC
AGTGAAAGAGGTGCAAGGAAAGCAGCCTCAGAAGAAGAAG
AAAGACAGGCGGAAAGGAAAACCAGGAGACGATGAAGATG
ATGATGAAGATTCAGAGGTCATGCAGCGTCTCAAGAAACT
GTCAGTCCAGGCTAGTGATGAGGAGGAGGAAGAAGAAGTT
GTTGTTCCAGCCAAAGGAGGAAAGAGAAACAAAGGTGGCA
ATATATTTGCTGCACTGAGCCAGGGGCAGAGTGATGATGA
AGATGATGAAGCTGGTGGTGATGATAATGATGATGATGAT
GACAAACCCAGAAGCAAGAAGAGCTCTAAGGAAGTTGAGA
AGGTAGCCAAGGGAAAGAAAAAAGATAAGCCTAAACCTAA
GCCAATAAAGGAGGCCTCAGAGGACGAGCAAGATGAAGGT
GCAGAGAAAAAAGATGAAAATGAAAAGAAAGGAGGGAAAA
AGGGCAAGAAAGCTGCTGCAGCTGCTAAACCATCTAAGGA
GGAAGATGATATTGAAGAGAAAGAACAAGAGAAGTCCCAG
AAAAAGGGCAAGAAGGAACCACCCAAGAAAGGGAAACCTG
CTCGTCCTCCTCCGAGTGATGATGATGAAGAGGAGGAAGA
AAAGAGTGATGACAATGACATAATGATGAGCGCAGAGGAT
GCGATTGCAGCTCAGGAAGCCAAGGAGAAACAAGATGATG
ACCCCTTTGCTAACATGAGTAAAAAAGAGAAGAAGAAAAA
AAAGAAAATAATGGAGTATGAGCGTCAGGTGGCGAGCGTT
CGTGCTCAGAATGCTATAGAAGGAGATTTCTCTGTTTCTC
AGGCTGAGCTGTCCTCTCGACAGGCCATGCTGGAGAATGC
TTCAGACATCAAGTTGGAAAGATTCAGCATTTCTGCTCAC
GGTAAAGAGCTGTTTGTTAATGCAGACCTTCTGATTGTTG
CTGGAAGACGATACGGTCTGGTTGGGCCAAATGGGAAAGG
GAAAACCACTTTACTGAAGCACATTGCTAACAGAGCTCTT
AGCATTCCTCCCAATATTGATGTCCTTCTTTGTGAGCAAG
AGGTGGTGGCGGACGACACTCCTGCAGTTCAGGCAGTGCT
GAAGGCCGACACGCGCAGACTGAAGCTCCTGGAGGAGGAA
CGGCAGCTCCAGAGCCGCTTGGAGAAAGGAGACGACAGCG
TGTCGGAGAGACTTGACAAGGTATATGAGGAGTTGAGGGC
GATTGGAGCCGCAGCAGCTGAGGCTAAAGCTCGTAGGATC
TTGGCTGGTCTTTCTTTCACTCCAGAGATGCAGAACAGAC
CCACCAAGAAGTTCTCTGGTGGTTGGAGGATGAGAGTGTC
ACTGGCTAGAGCGCTGTTTATGGAGCCCACTCTGCTCATG
CTGGACGAGCCCACTAACCACCTGGACCTGAACGCTGTCA
TCTGGCTTAACAACTATCTGCAAAGCTGGAAAAAAACACT
CCTAATTGTGTCCCACGACCAGAGTTTCTTAGATGACGTC
TGTACAGATATCATTCACTTGGACAATCAGAAACTCTACT
ACTACAGGGGCAATTACCTGACGTTTAAGAAGATGTACAT
CCAAAAACAGAAAGAACTCCAAAAGCAGTACGACAAACAA
GAGAAAAAGCTGAAAGACCTGAAGGCTGGAGGAAAGTCCA
CCAAACAAGCTGAGAAACAGACGAAAGAGGCTCTGACAAG
GAAACAGCAGAAGGGGAAGAAGAAAAGCCAGGAGGAGGAG
AGTCATGAGGCCACGGAGTTGCTGAAGAGACCCAAAGAAT
ATACTGTCAAATTTACCTTCCCCAATCCTCCGCCGCTCTC
GCCGCCAATTCTTGGCCTGCACAGTGTTGACTTCGGTTAT
GAAGGCCAGAAGCCTCTCTTTAAAAATGTGGACTTTGGAA
TTGACATGGAGTCTAGAATTTGTATTGTTGGGCCCAATGG
AGTCGGGAAGAGTACACTGCTTCTGCTTTTGACTGGGAAA
TTAAATCCTACAAAAGGAGAGATGAGGAAGAACCATCGAT
TGAAAGTAGGTTTCTTCAACCAACAGTATGCCGATCAGTT
GAACATGGATGAGGCCGCCACAGAATACCTGCAGAGGAAC
TTCAACCTCCAGTACCAGGATTCCAGGAAGTGTCTGGGTC
GCTTTGGGTTGGAGAGCCATGCACACACCATCCAGATTTC
CAAACTGTCTGGTGGACAGAAAGCCAGAGTGGTATTTTCT
GAACTCTCTTGTCGGCAGCCTGACGTCCTTATCTTGGATG
AGCCCACAAATAACTTGGACATTGAGTCAATTGATGCGTT
GTCAGAAGCCATCAATGAATATAAAGGAGCTGTGATAATT
GTGAGCCATGATGCCAGGCTGATCACAGAGACCCAGTGCC
AGCTGTGGGTGGTGGAGGACCAGTCAATCAACCAGATCGA
CGGAGACTTTGAAGACTACAAGAGAGAAGTGCTGGAGGCC
CTTGGTGAGACCCTGGTCAACAAGCCTAAAGAGTGAAGCA
CGGCCGGTGTTTATTACAGGAGTGTCAAACTACATCACTG
AAGGGCTTTTTGCTGCGTCTACATTGCTACTTCTCAATAG
AACCAAAAAGTACCTGCATGCAAACATACAAACCCTACAG
CTGCAGGACGAGTGAAAGCTGACGCCAGATCAGTATTTTC
ACATGCAGGGCTTGTTCTTTAGTCATGATGTCTGGCATTC
TTGTGTTAATCTTACATTCAGGTCATGTAATCACCAGCTC
TGTTCATCTTTCTGATGCAATGCTATTAAACCTGCTTTGT
AACTGATCGCCACAGTGGGAATTTATCAAATGTGAACAGA
GAGGACTAGAAGTGTGCCGTGTGATAACGGTGTCTGACTG
CTAATGCTATTTACTATTAATGCCACTTCATAGTATTGGC
TCTTGCGTTCACATCATTATATTATCATTGTGCTGACATA
CTGAACCAGCCTCAAACTGTTTCACCCTCACCTGTGTTCA
TACAGTGATGCATCTGTCTAGAATTATGAAATAAGCAGGG
CTGTTGACTCATTGGGTTTGGATAGAAACCGAAATTTAAA
TGATTTGAAAAAGCAAATAAATGATTT

abcf1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA abcf1-201 3347
abcf1-202 (1)    Ensembl 821
ncRNA abcf1-003 (1) 663
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
abcf1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000018339 (1),  Ensembl_Trans:ENSDART00000048977 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CD760271 (1) 924 bp
GenBank:CK400181 (1) 901 bp
GenBank:CK236499 (1) 862 bp
GenBank:BM775787 (1) 668 bp
GenBank:AW419959 (1) 627 bp
GenBank:BM777851 (1) 597 bp
GenBank:BQ075685 (1) 594 bp
GenBank:AI558687 (1) 588 bp
GenBank:BQ076832 (1) 569 bp
GenBank:BI673573 (1) 567 bp
GenBank:BQ075696 (1) 552 bp
GenBank:BI672808 (1) 538 bp
GenBank:AL909920 (1) 531 bp
GenBank:AI878383 (1) 528 bp
GenBank:BQ259189 (1) 494 bp
GenBank:AI667306 (1) 453 bp
GenBank:AW420716 (1) 341 bp
GenBank:AW421195 (1) 333 bp
GenBank:AI313740 (1) 332 bp
GenBank:BI474742 (1) 308 bp
GenBank:AI558453 (1) 190 bp
CITATIONS (2)