ZFIN ID: ZDB-TSCRIPT-090929-4046
Transcript Name: abcf1-202
Previous Name: abcf1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000018340 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000018340|OTTDARG00000015317|ZDB-GENE-050517-31 abcf1|OTTDARP00000015482 CH211-215A10.2-002 LG_ BX510301.6 Danio rerio protein_coding NOVEL, 821 bp
AGTGTGCTCGTGTTCATTGTCAGCTGTAAAACATCCCGCA
GTCTCCTTTAACACATTGGCTTTTCATTCTTAGCAAAAGA
AAAGGTTAAAAGAAAGATGCCTAAGAAGTCAAAAGAAAAG
GCTGAGTGGGAGGGTGATGATGAACCACAAACAGTAGACA
AACATGTCAAAAAAGGCAAGAAGGATAAGAAAGACAAGAA
GAGTTTTTTTGAGGAGCTGGCATCAGAGAATAAACCAGAA
AAAGAACAGCCACCAGTGAAAGAGGTGCAAGGAAAGCAGC
CTCAGAAGAAGAAGAAAGACAGGCGGAAAGGAAAACCAGG
AGACGATGAAGATGATGATGAAGATTCAGAGGTCATGCAG
CGTCTCAAGAAACTGTCAGTCCAGGCTAGTGATGAGGAGG
AGGAAGAAGAAGTTGTTGTTCCAGCCAAAGGAGGAAAGAG
AAACAAAGGTGGCAATATATTTGCTGCACTGAGCCAGGGG
CAGAGTGATGATGAAGATGATGAAGCTGGTGGTGATGATA
ATGATGATGATGATGACAAACCCAGAAGCAAGAAGAGCTC
TAAGGAGGCCTCAGAGGACGAGCAAGATGAAGGTGCAGAG
AAAAAAGATGAAAATGAAAAGAAAGGAGGGAAAAAGGGCA
AGAAAGCTGCTGCAGCTGCTAAACCATCTAAGGAGGAAGA
TGATATTGAAGAGAAAGAACAAGAGAAGTCCCAGAAAAAG
GGCAAGAAGGAACCACCCAAGAAAGGGAAACCTGCTCGTC
CTCCTCCGAGTGATGATGATGAAGAGGAGGAAGAAAAGAG
TGATGACAATGACATAATGAT

abcf1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA abcf1-201 (1)    Ensembl 3347
abcf1-202 821
ncRNA abcf1-003 (1) 663
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
abcf1-202 Contained in:
[BAC] CH211-215A10 (1)

Genome Resources: Vega_Trans:OTTDART00000018340 (1),  Ensembl_Trans:ENSDART00000073705 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CK396858 (1) 838 bp
CITATIONS (2)