ZFIN ID: ZDB-TSCRIPT-090929-4040
Transcript Name: ppp1r10-202
Previous Name: ppp1r10-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000018321 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000018321|OTTDARG00000015303|ZDB-GENE-020419-15 ppp1r10|OTTDARP00000015466 ppp1r10-002 LG_none BX547939.11,BX510301.6 Danio rerio protein_coding KNOWN, 3723 bp
AGACGAAAATAATTGTATTATAGTCAGGCCAACACTGTAT
TGCTCTGTTGACAAGTTCTCAATCAATCCTTGTAAGCAGC
CATGGCCGTGGGCCCAGTGGACCCCAGAGAGGTGTTGAAA
GGAGTTGAAGCTCTGCTGGGGAAGGATGGAGAACTACGTA
GTCTTGAGGGAGTCGCTAAAGTCTTCAGTCTGATGAAGGC
CTCACATAAAATGGTCAGCAGATGCATGTATCTGAACATA
TTACTTCAGACAAAATCACATGATGTGCTAAATCGATTCA
TTCGAGTTGGAGGCTACAAGTTGTTGAACTCTTGGCTCAC
CTACTCGAAGACCACCACCAACACGCCTCTGTTGCAGCTC
ATTCTGCTGACCCTGCAGAAGCTTCCTCTTACTGTGGACC
ACCTCAAACAGAATAACACTGCCAAGCTGGTGAAACATCT
GAGCAAGAGCGGAGAGACAGAAGAGCTGAGGAAGTTGGCA
TCTGTGCTGGTGGATGGCTGGATGGCTATTATTCGCTCTC
AGAGCGTCTCCAGTGGAGCATCGCCTAATGACAAGAAACG
GAAAAAGGAGGATGGAAAAGTGCGTCCAGAGGTGAAGCCA
AAGGAAAAGGCAGCTGAGGAGGAGAAGAAGAAGGACAAAC
CAAAAGCTTATGCTCCAAGTCATGCTAAGATCCGCTCTAC
AGGTTTGGAGGTGGAGAGTCCGGCTCCAGTTCCTGTGAAG
AAGCCACCCGTTGCACCCCAACTTGGAGACAAATACAACA
TCAAGCCAGCTGTACTTAAAAGACCAAGCACATCTTTGAC
TGACGCACCACCAGTGGAAAAGAAGTACAAGCCACTTAAC
ACCACCCCCAACTCAACCAAAGAGATCAAAGTCAAACTCA
TACCCCCACAGCCGATGGAGGCCACTGGATTTTTGGACGC
CCTCAACTCTGCTCCAGTGCCTGGCATCAAGATCAAGAAA
AAGAAACCAAAAGCAGTTTCACCCACCAGTAATAAGCCCT
GTCCATTTGACAGCAGGCCGCAGTCATTTTCAGGCGCACA
GGCCAAACCATCTTCCCCTGAAACGCCTTCATCTCAAACC
CCTCCTCATGAGAATCAAGAACTGGAGCAGCCTGGCACAC
CCGTGCCCACCGAGGAGCCTGAAGCCATGGAAACCGGTGA
TAAACCCAATGCTCTGGCTGAACCTCGCAGCGAGGAGGAG
ACTCTGACTAAGAAAGGAAAGAAGAAGAAAAGCGTGCGGT
GGGCGGAAGAGGATCATCTCAAAGAGTACTTCTATTTCGA
TCTGGATGAAACTGAGAGAGTGAATGTGAACAAAATTAAG
GACTTTGGTGAGGCGGCTAAGCGGGAGCTGATGATGGACA
GGCAGACGTTTGAAATGGCTCGTCGTCTTTCTCATGACAC
CATGGAGGAGAGGGTGCCCTGGACCCCACCGCGACCCTTG
ACCCTATTAGGCTGCCTGGTCACTGCAGGTGCCAGCAGCC
GAGAGAAGATGATCCAGAGAGACCGAGAGATGGGCATTCT
GCAGGAGATCTTCCTCTGCAAGGAGAGTGTTCCAGACAGT
CCTCATGAGCCAGATCCTGAGCCGTATGAGCCCATGCCTC
CTCGTCTCATCCCACTGGACGAGGATAGCAGTATAGTAGA
GGACATGGATTCCACTGATCCTGCCTCTACTCCCGGCTCT
AATGAAGGCTCCAAGCTGCCTCCTGTATTAGCCAACCTCA
TGGGCAGCCTGGGCAACAGCGGCCGCAGCCCGCAGGCACA
GGGCAATGCCCCACAAGCCAATAATAATAATAATAACCCA
GCTGTTAATGTGCAGGAACTACTCTCATCTATCATGGGTG
CACACGGATCTAATCAGTCTCCAGAAGACCTGATCAAACA
GCCGGATTTCTCTGATAAGATCAAGCAGCTTTTGGGTTCT
CTGCAGCAAAACCAGAATCAGAACGCGCCTCCCAATGCTC
CACCAATGAACCCTGGTCTCCTTGGTCATGGTCCCGGCAT
GAATATGAACAACATGAACAACATGCAGATGCCCATGAAT
GGTGGTTTCCCTCCAAACAAGCCTCCTGGACCACATTTCA
ACCATCCTCCACCTCCACATGGTCATGGCCCACCCTTCAA
TGCCGGAGGCCCTGGGCCTGGCCCTGGCCCTCGTATGATG
GGTCCTCCACCCGGCCCACAGGGACGAGGAGCAGACAATG
GAAACTACTGGGGCGATGACTCAATGAGAGGAGGCCCACA
CCGGGGAGGCTTTCACCGGGGCCGAGGAAGAGGAGTAGAT
CCAGGCTTCAGAGGGCGAGGGGGGCGCGGAGGACCACGTG
GGGGACATAACAACATGGGTGATATGTCAAATAGGCCAGT
GTGTCGGCATTTCATGATGAAGGGAAATTGTCGTTATGAA
AATAACTGTGCGTTTTATCACCCTGGTGTAAACGGACCAC
CTCTACCTCCTCAACACGGACACTAGCATGCTGTAAAGCT
GCCGTTGCTAGAACTCGCCACTAGTGGGCAACAGGACTCA
AACTGAGCCTCGTTTACAGTAGCTGAACCTGATTAACAGG
AACAGGATGACGTGGAGGGGATGCTTTTTTTTGCGTCTGT
GACTGCACAATCCCATCTGCTTCACCAAAATCCTCTCAGT
TTTACACTACTTTTCTGACCTGGAAAGTTAGGAGAAAAAT
CTGAGATCCTCTATGAAGAGTGACTAAACCCAATACTAGG
CTTTGGGGCCTCCGTGTAAATAGTGATTCCTGAAGATGGT
GATGTATATTTTTTTATTGTGATTCCGTGTACCACTGACC
TGACTGCTAAAGATTGTACTACGTTGCTCTGTAACCACTA
TGACTAAGGTGTAAATAATCGTCTTCAGACAGTGATGTGC
AGTTACTTAAGCTTTCCCTGGTGCCCGAAGCCCTAAGAAA
CTAGATGTGCAATTTTTCCAAAACAGAATTTGCACATCAA
TCATTAATGCACCTTGCATTTGCATAATGAAATCGACACT
TTCAGAAGTATTCAGTCCCTCTGAAGCGGCCAGAAGATGG
CGCACTGGTTAAAGTTTTAATTTAAGGTTTCTGTAGGACA
AGGAGAAACCAAACTTAATATGAAATGCTTTGAAATTTTC
AGATTTTCGGTCAGTCGGCATGAAAAGTGCCTCAGGTTAT
TTTCACTCACGGTCCCTTTTTTCAATGATTTTCACCTGGG
CACAAACTACAATGTTTTTTGAAGTCCCGTTGCTTACTTG
AATTGATACTTTGTGATGAAAAGTGATCTTAGCCTGCTTA
AAAAAAAATCAGCTATTGTTCGTGGTAGTGTGACAATCAG
GAGAATTAGCTGGGATGATTTCCTACTTGATGTTGATGCT
GTTTGATTTGCTGTGCGTTCATGTTCTCATGCTGTCAGAA
GCTCGGTCTAGATCAGACTCGTGTGGGTCTGTCCTGCTCT
ATCAGTGTTTAACTGAGTCTAACCTAGGCTGCAAACCACT
ATGAAGGCCAAACTTATTCTGGTGTTTTCTGTGAAAACAG
TGGCCATTGTCTCTTGTGGGACTTTATTTTCTTTTTTTTT
TTGGTTTGATCCACTATTTTCCCATGATTTTATTTTGATA
CAAGTCAGATTTTTTTCTATTGTTTGAGAAATGTCTATGT
GTCAGATTGCCGCATAAACACAACAAAAGGCACATTTTGA
ATTTTTTTTTCTACATGTAAATTAATAAATGTTCAGAAAT
TCA

ppp1r10 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ppp1r10-202 3723
ppp1r10-203 (1)    Ensembl 3961
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ppp1r10-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000018321 (1),  Ensembl_Trans:ENSDART00000144121 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC048892 (1) 3738 bp
GenBank:BF156551 (1) 547 bp
CITATIONS (2)