ZFIN ID: ZDB-TSCRIPT-090929-4039
Transcript Name: ppp1r10-203
Previous Name: ppp1r10-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000018320 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000018320|OTTDARG00000015303|ZDB-GENE-020419-15 ppp1r10|OTTDARP00000015465 ppp1r10-001 LG_none BX547939.11,BX510301.6 Danio rerio protein_coding KNOWN, 3961 bp
CTGAGTCGGTCTCAGTGAAGATCTGGCGTCGAGGATTTTT
CAACTGTGTACGAAGAGAAAACCCCAAAATCTCTTACTTT
TTTCTACTCGAGTAACGGACATTCGCTTACTACCTTTTTT
GCTCCAGATTGTTCAAGAAGGAAAATCTCAATTTCAGCCA
CCACAATCCCGCCCATTATGCCATTTTTCAGCCAATAATG
CTTAAGTCATGACAGTTTACGTTCTCTTAAACTGTTATAA
AGCTGAAATTTGTTGCTGTTAAGCACAAAATATTAATAGC
AACCCGAGACGCAGAGGAGAGGTATTAATATAAGCAGCCA
TGGCCGTGGGCCCAGTGGACCCCAGAGAGGTGTTGAAAGG
AGTTGAAGCTCTGCTGGGGAAGGATGGAGAACTACGTAGT
CTTGAGGGAGTCGCTAAAGTCTTCAGTCTGATGAAGGCCT
CACATAAAATGGTCAGCAGATGCATGTATCTGAACATATT
ACTTCAGACAAAATCACATGATGTGCTAAATCGATTCATT
CGAGTTGGAGGCTACAAGTTGTTGAACTCTTGGCTCACCT
ACTCGAAGACCACCACCAACACGCCTCTGTTGCAGCTCAT
TCTGCTGACCCTGCAGAAGCTTCCTCTTACTGTGGACCAC
CTCAAACAGAATAACACTGCCAAGCTGGTGAAACATCTGA
GCAAGAGCGGAGAGACAGAAGAGCTGAGGAAGTTGGCATC
TGTGCTGGTGGATGGCTGGATGGCTATTATTCGCTCTCAG
AGCGTCTCCAGTGGAGCATCGCCTAATGACAAGAAACGGA
AAAAGGAGGATGGAAAAGTGCGTCCAGAGGTGAAGCCAAA
GGAAAAGGCAGCTGAGGAGGAGAAGAAGAAGGACAAACCA
AAAGCTTATGCTCCAAGTCATGCTAAGATCCGCTCTACAG
GTTTGGAGGTGGAGAGTCCGGCTCCAGTTCCTGTGAAGAA
GCCACCCGTTGCACCCCAACTTGGAGACAAATACAACATC
AAGCCAGCTGTACTTAAAAGACCAAGCACATCTTTGACTG
ACGCACCACCAGTGGAAAAGAAGTACAAGCCACTTAACAC
CACCCCCAACTCAACCAAAGAGATCAAAGTCAAACTCATA
CCCCCACAGCCGATGGAGGCCACTGGATTTTTGGACGCCC
TCAACTCTGCTCCAGTGCCTGGCATCAAGATCAAGAAAAA
GAAACCAAAAGCAGTTTCACCCACCAGTAATAAGCCCTGT
CCATTTGACAGCAGGCCGCAGTCATTTTCAGGCGCACAGG
CCAAACCATCTTCCCCTGAAACGCCTTCATCTCAAACCCC
TCCTCATGAGAATCAAGAACTGGAGCAGCCTGGCACACCC
GTGCCCACCGAGGAGCCTGAAGCCATGGAAACCGGTGATA
AACCCAATGCTCTGGCTGAACCTCGCAGCGAGGAGGAGAC
TCTGACTAAGAAAGGAAAGAAGAAGAAAAGCGTGCGGTGG
GCGGAAGAGGATCATCTCAAAGAGTACTTCTATTTCGATC
TGGATGAAACTGAGAGAGTGAATGTGAACAAAATTAAGGA
CTTTGGTGAGGCGGCTAAGCGGGAGCTGATGATGGACAGG
CAGACGTTTGAAATGGCTCGTCGTCTTTCTCATGACACCA
TGGAGGAGAGGGTGCCCTGGACCCCACCGCGACCCTTGAC
CCTATTAGGCTGCCTGGTCACTGCAGGTGCCAGCAGCCGA
GAGAAGATGATCCAGAGAGACCGAGAGATGGGCATTCTGC
AGGAGATCTTCCTCTGCAAGGAGAGTGTTCCAGACAGTCC
TCATGAGCCAGATCCTGAGCCGTATGAGCCCATGCCTCCT
CGTCTCATCCCACTGGACGAGGATAGCAGTATAGTAGAGG
ACATGGATTCCACTGATCCTGCCTCTACTCCCGGCTCTAA
TGAAGGCTCCAAGCTGCCTCCTGTATTAGCCAACCTCATG
GGCAGCCTGGGCAACAGCGGCCGCAGCCCGCAGGCACAGG
GCAATGCCCCACAAGCCAATAATAATAATAATAACCCAGC
TGTTAATGTGCAGGAACTACTCTCATCTATCATGGGTGCA
CACGGATCTAATCAGTCTCCAGAAGACCTGATCAAACAGC
CGGATTTCTCTGATAAGATCAAGCAGCTTTTGGGTTCTCT
GCAGCAAAACCAGAATCAGAACGCGCCTCCCAATGCTCCA
CCAATGAACCCTGGTCTCCTTGGTCATGGTCCCGGCATGA
ATATGAACAACATGAACAACATGCAGATGCCCATGAATGG
TGGTTTCCCTCCAAACAAGCCTCCTGGACCACATTTCAAC
CATCCTCCACCTCCACATGGTCATGGCCCACCCTTCAATG
CCGGAGGCCCTGGGCCTGGCCCTGGCCCTCGTATGATGGG
TCCTCCACCCGGCCCACAGGGACGAGGAGCAGACAATGGA
AACTACTGGGGCGATGACTCAATGAGAGGAGGCCCACACC
GGGGAGGCTTTCACCGGGGCCGAGGAAGAGGAGTAGATCC
AGGCTTCAGAGGGCGAGGGGGGCGCGGAGGACCACGTGGG
GGACATAACAACATGGGTGATATGTCAAATAGGCCAGTGT
GTCGGCATTTCATGATGAAGGGAAATTGTCGTTATGAAAA
TAACTGTGCGTTTTATCACCCTGGTGTAAACGGACCACCT
CTACCTCCTCAACACGGACACTAGCATGCTGTAAAGCTGC
CGTTGCTAGAACTCGCCACTAGTGGGCAACAGGACTCAAA
CTGAGCCTCGTTTACAGTAGCTGAACCTGATTAACAGGAA
CAGGATGACGTGGAGGGGATGCTTTTTTTTGCGTCTGTGA
CTGCACAATCCCATCTGCTTCACCAAAATCCTCTCAGTTT
TACACTACTTTTCTGACCTGGAAAGTTAGGAGAAAAATCT
GAGATCCTCTATGAAGAGTGACTAAACCCAATACTAGGCT
TTGGGGCCTCCGTGTAAATAGTGATTCCTGAAGATGGTGA
TGTATATTTTTTTATTGTGATTCCGTGTACCACTGACCTG
ACTGCTAAAGATTGTACTACGTTGCTCTGTAACCACTATG
ACTAAGGTGTAAATAATCGTCTTCAGACAGTGATGTGCAG
TTACTTAAGCTTTCCCTGGTGCCCGAAGCCCTAAGAAACT
AGATGTGCAATTTTTCCAAAACAGAATTTGCACATCAATC
ATTAATGCACCTTGCATTTGCATAATGAAATCGACACTTT
CAGAAGTATTCAGTCCCTCTGAAGCGGCCAGAAGATGGCG
CACTGGTTAAAGTTTTAATTTAAGGTTTCTGTAGGACAAG
GAGAAACCAAACTTAATATGAAATGCTTTGAAATTTTCAG
ATTTTCGGTCAGTCGGCATGAAAAGTGCCTCAGGTTATTT
TCACTCACGGTCCCTTTTTTCAATGATTTTCACCTGGGCA
CAAACTACAATGTTTTTTGAAGTCCCGTTGCTTACTTGAA
TTGATACTTTGTGATGAAAAGTGATCTTAGCCTGCTTAAA
AAAAAATCAGCTATTGTTCGTGGTAGTGTGACAATCAGGA
GAATTAGCTGGGATGATTTCCTACTTGATGTTGATGCTGT
TTGATTTGCTGTGCGTTCATGTTCTCATGCTGTCAGAAGC
TCGGTCTAGATCAGACTCGTGTGGGTCTGTCCTGCTCTAT
CAGTGTTTAACTGAGTCTAACCTAGGCTGCAAACCACTAT
GAAGGCCAAACTTATTCTGGTGTTTTCTGTGAAAACAGTG
GCCATTGTCTCTTGTGGGACTTTATTTTCTTTTTTTTTTT
GGTTTGATCCACTATTTTCCCATGATTTTATTTTGATACA
AGTCAGATTTTTTTCTATTGTTTGAGAAATGTCTATGTGT
CAGATTGCCGCATAAACACAACAAAAGGCACATTTTGAAT
TTTTTTTTCTACATGTAAATTAATAAATGTTCAGAAATTC
A

ppp1r10 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ppp1r10-202 (1)    Ensembl 3723
ppp1r10-203 3961
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ppp1r10-203 Contained in:

Genome Resources: Vega_Trans:OTTDART00000018320 (1),  Ensembl_Trans:ENSDART00000144265 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AF506227 (1) 2364 bp
GenBank:CA975842 (1) 903 bp
GenBank:CD053118 (1) 833 bp
GenBank:CK018242 (1) 813 bp
GenBank:CD053141 (1) 782 bp
GenBank:CF996547 (1) 761 bp
GenBank:AW128419 (1) 662 bp
GenBank:BI533789 (1) 641 bp
GenBank:BM024211 (1) 634 bp
GenBank:BI476632 (1) 632 bp
GenBank:BI845173 (1) 624 bp
GenBank:BM024455 (1) 614 bp
GenBank:BM023678 (1) 612 bp
GenBank:BM023900 (1) 611 bp
GenBank:BI705629 (1) 589 bp
GenBank:BM070751 (1) 589 bp
GenBank:BG737363 (1) 578 bp
GenBank:BM024994 (1) 575 bp
GenBank:BI706491 (1) 574 bp
GenBank:BM071478 (1) 570 bp
GenBank:BG728887 (1) 552 bp
GenBank:BG304715 (1) 547 bp
GenBank:AW826578 (1) 522 bp
GenBank:BG308870 (1) 502 bp
GenBank:CB361265 (1) 461 bp
GenBank:BG883172 (1) 405 bp
GenBank:AW826873 (1) 384 bp
CITATIONS (2)