Transcript

creld2-002

ID
ZDB-TSCRIPT-090929-2348
Name
creld2-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000012887 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000012887|OTTDARG00000011097|ZDB-GENE-040426-1626 creld2|no_translation DKEY-164M14.2-002 LG_ CR751234.13 Danio rerio protein_coding KNOWN, 670 bp
GTTACAGAGGGGCTGACGCGGAAATCCGAATATCTAACCG
GACTTTACAGCATTATGCTCAACTTGCCGACAGCTAGTAG
ACGATTTTGACAAGGGTTTGGAAAAAACAGCAAAGCAAAA
TTTTGGGGGTGGAAACACAGCGTGGGAAGAACGTAAACTA
TCTAAATATGAGACGAGTGAGATTAGGCTGACGGAGATCC
TGGAGGGCTTGTGTCAAAGCAGCAATTTTGAGTGCAGCCA
TATGTTGGAAGAAAATGAGGAACACTTAGAGGCATGGTGG
TTCAAGAGGAAAACCAAACACCCAGATCTTTTTAAGTGGT
TTTGTATAGAGACCATCAAAGTGTGCTGCCCTAAAGGCTC
ATTTGGTCCTGACTGCAATACTTGCATTGGAGGAGCTGAC
AGACCATGCCACGGGAATGGTAAATGCGATGGAGATGGTA
CAAGGGCTGGAAATGGGAAATGCAGTTGTGATGAAGGATA
TGATGGGGAGTTTTGTCTGGACTGCAGTGATGGATATTTT
AATTCACTGAGGAATGACACATTCTTCTTGTGCAAAGAGT
GTCATGAGTCTTGTGTTGGGTGCAGTGGAGGAACCAATCA
GCATTGTAAAGAATGTAGGAATGGTTGGGTTAAAGACCAA
GAAGGATCTTGCATTGACATCAATGAATGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations