Transcript

creld2-201

ID
ZDB-TSCRIPT-090929-2347
Name
creld2-201
Previous Names
  • creld2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000012886 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000012886|OTTDARG00000011097|ZDB-GENE-040426-1626 creld2|OTTDARP00000011063 DKEY-164M14.2-001 LG_ CR751234.13 Danio rerio protein_coding KNOWN, 1505 bp
TTGTAAATGTGACGTGCTACATGTCTTGATAATAAACGTG
TCGTAATCTCAGACGTTAGATGTTGATTAATATGTATATA
TTTTTAACTTGCTAAGGATAGCCCAGAAAAAAAACTAATA
TCTTATTGGGCAACATTTGTTGTAGACAGTACACTTGATG
ACAACATGTTACTCTCATGTAGTATTTTTCGTTTATTTTG
TATAATTTTGCTTCTGCAACTTGGATCTATTTATACAAAG
GACTTTACAGCATTATGCTCAACTTGCCGACAGCTAGTAG
ACGATTTTGACAAGGGTTTGGAAAAAACAGCAAAGCAAAA
TTTTGGGGGTGGAAACACAGCGTGGGAAGAACGTAAACTA
TCTAAATATGAGACGAGTGAGATTAGGCTGACGGAGATCC
TGGAGGGCTTGTGTCAAAGCAGCAATTTTGAGTGCAGCCA
TATGTTGGAAGAAAATGAGGAACACTTAGAGGCATGGTGG
TTCAAGAGGAAAACCAAACACCCAGATCTTTTTAAGTGGT
TTTGTATAGAGACCATCAAAGTGTGCTGCCCTAAAGGCTC
ATTTGGTCCTGACTGCAATACTTGCATTGGAGGAGCTGAC
AGACCATGCCACGGGAATGGTAAATGCGATGGAGATGGTA
CAAGGGCTGGAAATGGGAAATGCAGTTGTGATGAAGGATA
TGATGGGGAGTTTTGTCTGGACTGCAGTGATGGATATTTT
AATTCACTGAGGAATGACACATTCTTCTTGTGCAAAGAGT
GTCATGAGTCTTGTGTTGGGTGCAGTGGAGGAACCAATCA
GCATTGTAAAGAATGTAGGAATGGTTGGGTTAAAGACCAA
GAAGGATCTTGCATTGACATCAATGAATGCATCAAAGATC
CAGCACCATGCAGTGATGACCAGTACTGCCTGAACACAGA
TGGCTCTTTCTCCTGTAAAGCATGTGATATCAGATGCACT
GGATGCAAAGGAGATGGTGCCAGTAGCTGCCTTAACTGTG
CTGATGGCTATAAGGACGAAGAAGGCACTTGCACAGACAT
TGATGAATGCACTGAAGACCCAGCTTCATGCAGTGATAAC
CAGCATTGCCTAAACACAGATGGTTCTTTCTCCTGTGAAG
AAAAAGTTCCTGCATTTAATTCTGAAGGTGCCAAAACTGG
TGACTCACCTGAAAAACATGAAGACCTCTGATGTCACTTG
GCTTGGATTGCAGAAGACAACCACCAAGACACAAGACTTT
TACCCGCCCCAGTCAATACTGGTCTTCACCTTAAATTAAC
AAGACTGAAAGGCAACTACAGTAAATCCTTAAGGAAACTG
TACTTTTTAACTTGTGGCACATGGATAGCACATTTATGCA
GTAAAAGGATTTGTGGACTTTGTGGACTGTTAGGTCCACT
TTATCAGAGAAGAGGATTTAAATGACGCATTTTTTTTTTT
TTTTTTGTGTTTACTTTTTTTGGTATATTTGTTTTGAAAT
TTAAATAAAGATAAAAAAAAATAGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations