Transcript

cars2-002

ID
ZDB-TSCRIPT-090929-21693
Name
cars2-002
Previous Names
  • si:ch211-198k9.5-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041879 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041879|OTTDARG00000030274|ZDB-GENE-030131-5564 cars2|no_translation CH211-198K9.5-002 LG_ BX908780.7 Danio rerio protein_coding NOVEL, 798 bp
CCATGAGTTGAGTTTAGAGCGATTTAATTTTATCAGTAAT
GCACCGACCGAGATGCTTACATATTTTTGCAATGACAGGT
CGATGAGGTTATAGCCTATGAACCAACTGCAAAATCTAAA
CATCTAAAATGCGTTTAAATGTCTTGTTATATTGCGGTTT
AAGGTCATCTCAGTAACGCAATCTTTTAAACTCTATTCAA
ATACTTTGCGTTTTACGAATGTAACTTAGGATGACAATGA
GGCTGGCTTCAGCACTGATACTTAATTCTGGCTTTAGAAT
CAGGCGTGAAATTCATAGTGGAGTTACAAAAACGTCATTA
CTGTGCCGTCGTACTGCATGCAGCAGGACGGAAAGAGGGT
GGGTAAAACCAGTGGGTTTTGACACCGGTGTAACGGCTTA
CAATAGTCTTACCAAGAAGAAAGAACCTTTAATTCTGTCA
CAAGAAAAAATTGCTACCTGGTATAGCTGTGGACCGACTG
TTTATGATCATGCCCATCTGGGTCATGCGTGTTCATATGT
CAGATTTGATATTCTCCAAAGGATATTATCAAGACTTTTT
GGAATTAATGTCATTCATGTTATGGTCATCACTGACATTG
ATGATAAAATCATACAAAGAAGCCTTGAGGAGAACATCTC
ACCCATCACTCTTGCAAGAATGCACGAGGAAGAATTTAAA
AAGGATATGCTAGCACTGCGGGTAAATCACCATTTTTTGT
GTTAATATTTCCTGAAATGTTAATACGTCTTACAATTTTT
TGTTTGTTTGTCCAGGTTCTTCCTCCCGTAGTATATAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations