Transcript

cars2-201

ID
ZDB-TSCRIPT-090929-21692
Name
cars2-201
Previous Names
  • cars2-001
  • si:ch211-198k9.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041878 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041878|OTTDARG00000030274|ZDB-GENE-030131-5564 cars2|OTTDARP00000033389 CH211-198K9.5-001 LG_ BX908780.7 Danio rerio protein_coding NOVEL, 2236 bp
AAGAAGATGACCATGAGTTGAGTTTAGAGCGATTTAATTT
TATCAGTAATGCACCGACCGAGATGCTTACATATTTTTGC
AATGACAGGTCGATGAGGTTATAGCCTATGAACCAACTGC
AAAATCTAAACATCTAAAATGCGTTTAAATGTCTTGTTAT
ATTGCGGTTTAAGGTCATCTCAGTAACGCAATCTTTTAAA
CTCTATTCAAATACTTTGCGTTTTACGAATGTAACTTAGG
ATGACAATGAGGCTGGCTTCAGCACTGATACTTAATTCTG
GCTTTAGAATCAGGCGTGAAATTCATAGTGGAGTTACAAA
AACGTCATTACTGTGCCGTCGTACTGCATGCAGCAGGACG
GAAAGAGGGTGGGTAAAACCAGTGGGTTTTGACACCGGTG
TAACGGCTTACAATAGTCTTACCAAGAAGAAAGAACCTTT
AATTCTGTCACAAGAAAAAATTGCTACCTGGTATAGCTGT
GGACCGACTGTTTATGATCATGCCCATCTGGGTCATGCGT
GTTCATATGTCAGATTTGATATTCTCCAAAGGATATTATC
AAGACTTTTTGGAATTAATGTCATTCATGTTATGGTCATC
ACTGACATTGATGATAAAATCATACAAAGAAGCCTTGAGG
AGAACATCTCACCCATCACTCTTGCAAGAATGCACGAGGA
AGAATTTAAAAAGGATATGCTAGCACTGCGGGTTCTTCCT
CCCGTAGTATATATGAGGGTGACAGAAAATATACCTCAAA
TTATAGCTTTTATAGAGCGTATTATTGGAAATGGACATGC
CTATGTCACAAGTCAAGGGAATGTCTACTTTAACACGAAG
TCTATTAGTCATCGTTATGGCAAGCTTGTCAATCTTGGAG
GAAATGCTGGGGAACAGGGGGTTCAGGACAAAGAGAATTC
AAGAGACTTTGCTTTGTGGAAAGCATCCAAACCATTTGAA
CCTTACTGGGAGTCACCTTGGGGACAAGGAAGACCTGGGT
GGCACATTGAATGTTCCACAATTGCTAGCTCAGTGTTTGG
ACATCAGCTGGATATACACTCTGGAGGGATTGACCTTGCC
TTCCCACACCATGAGAATGAAATTGCCCAGTCAGAGGCAT
ATCATCAGTGTGAACAGTGGGGAAACTACTTTCTACACTC
TGGGCACCTTCATTTAAAAGGAAGTGTAGAGAAGATGTCA
AAATCCTTGAAGAATTATGTAACTATAAAGGATTTTCTGG
CATCTTATACTGCTAATGAGTTTCGACTTTTCTGTCTTCT
GACCAAATACAGATCAGCAATCGACTATAGTGATGCTAGC
ATGAATGAAGCCCAATCTACACTGTCCACCATCTCTGCCT
TCTTCCACAATGCACAGGCCTACATGCAGGGCCACATGCA
GTGCCAGCCTGTAGAGGAAGGATTTCTCTGGGAGAGGTTG
TCTAATACTCAGACCAGTGTTCATAAAATGCTTGCCGATG
ACTTTGACACACCAAAAGCTGTGGATGCCATCATGAGTCT
CATTTACCATGGCAACTGTCAGCTTCAGCCTGCTACTAAG
GTGGATGGGCCTAGGAGTCCTGCTGTATTTGGAGCCATAA
TGTCCTATGTTATGGAAATAATGAGTGTTTTTGGAGTGGA
TCTATCAGACAAAACGGAAGTCCAAGTTTCCTCTGGAGTT
TTGAATAATGTTGTGGAGGAGTTGGTTCATTTTCGGAGTG
AAGTTCGTAAATTTGCTCTTTCTGTGGAAGACCAAGCACC
ACAGGAATCCCAGACTGGCAATAAAAATCAGAAAAGGCAT
CATCAACCAGACAGATTACACTTAAGCTTACTGAAAGCGT
GTGATGCCTTAAGGAATAATCTAGCACCCCTTGGAGTCCA
CATTAAGGATAGAGGCACCAACTCCACGTGGGAGGTAACA
AAGGCAGAGACGAGGAAGTAGTCCCTAACTGAATTTTAAC
AAACTGTATTGATTAGGACTCAGTTTAAGCGCTTTAATTT
TTTTCTTACTAATGCAACTAAATCTGGAAAGCACATTTAT
GTATTATTGTCATTTTCAATAAATCTGTTAAATGTTTATC
ATAAACTTTTGATACAACTTCTGTAGCAGTAAAGTGTATT
AGGACAGGGTCATGAAGTTACTAAAGCAAAGCATTTTAAT
AGGTGCCATTAGCATATAAAACTTAAGCAAAATTACACAT
TGTTTTTCAGTTAGCTGATTTTTACTCAAATGTTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations