header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-20833
Transcript Name: slx4ip-002
Previous Name: zgc:64090-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000040726 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000040726|OTTDARG00000029642|ZDB-GENE-040426-1365 slx4ip|no_translation CH211-159E5.2-002 LG_ CU138575.8 Danio rerio protein_coding KNOWN, 740 bp
AAGTGTGGGAATTACGCCGTGCTGGTGGATCTTCACATAT
TGGCCTTAGGCGACCAAGACAATGCCAACTGGTTCTCTCC
AGCGCACAGGAAGGAAGTGGGCTCTTTGATTAGGGATGCA
TTGGAGCCCAGGGTGAGGCAGTTCCAAGAGGCCAGATACC
AGAAGATCCAGTCCAAACCAAGGAAAGATCTCACCCCGAC
TGCCCCTCTTTGTCTTGAAGGTGGACATTGAACAGAGTGA
TAAGACACACCGCCCGCTCGGCCCAGGCTACAGTTACGCA
GCCGGGTGTGATGTGCTTCCAGGAAAACCCCGTTCGGCCC
TTCCATGTGGCGACCCCCGTGAAACGCTCACACACATTCG
CACAATCGCCTACGAGCCCCACCCTGACCCAGTAAGAGCG
AAGGACAAGATCTTAGAGGGTGATCATTCACATCAAAGTG
AGGACGGAGAGAAAATATTTCTACAAATTCCTACTCGGTC
ATCTAGACACCCGCTTTCCACCCGACGTTCCTGGGTTTTC
ACATCTAGGAGATCACTTCAGGATCGCCCATTACACACAC
AGTAGCCATGTGCTCAGATATCACTTGTCATACCCGGTTT
TGCCACCAGAAATCGTATCTGATGTTGCCTGTTTTTCAAG
CTCAATGTGTTTAGATTGTACAACCTCTTTGGCTTGTCTC
GATCTAGACTGTTGTGCTGAGAGATGATTATTATTCTTTC
ACATGTTGAGCTGTCTGTGC

slx4ip TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA slx4ip-203 (1)    Ensembl 2386
ncRNA slx4ip-002 740
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slx4ip-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000040726 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CV489420 (1) 883 bp
GenBank:BQ285406 (1) 585 bp
CITATIONS (1)