ZFIN ID: ZDB-TSCRIPT-090929-20832
Transcript Name: slx4ip-203
Previous Names: slx4ip-001, zgc:64090-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000040725 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000040725|OTTDARG00000029642|ZDB-GENE-040426-1365 slx4ip|OTTDARP00000032548 CH211-159E5.2-001 LG_ CU138575.8 Danio rerio protein_coding KNOWN, 2386 bp
TGTGGGAATTACGCCGTGCTGGTGGATCTTCACATATTGG
CCTTAGGCGACCAAGACAATGCCAACTGGTTCTCTCCAGC
GCACAGGAAGGAAGTGGGCTCTTTGATTAGGGATGCATTG
GAGCCCAGGGTGAGGCAGTTCCAAGAGGCCAGATACCAGA
AGATCCAGTCCAAACCAAGGAAAGATCTCACCCCGACTGC
CCCTCTTTGTCTTGAAGGTGGGAATGTTCGCCTAGCGGTG
CACTTCATGAAACGTCATGTCAACCTGAGATGCATTGTCA
GGCAGCACTACAGAGAGTTGCGTGTATTTCCCGAGCGTGT
TGTAGTGTGTGCCAGTCCTCCAGAGAATTCCGCACTTCCC
AATGGAAATCTGAACCTGGATGTGAGTGAACAGAGTCAGT
CAAAATACTTTTCTAACTCTGGTGAGACGGCAAATCCATT
ACCAATCTCCACAGCTACAAAAAGAGCTGTCCTTCAGAAG
ATTGCCAGAAAGACAAAAATCCAGCCCCCACGATCGCAAG
ATAATCAAGAGTCCAAAACAGGACAATTTCAAGCAGACAA
TGCAGAGAAGGGCTCTAGATCTGTCCTTCAGAGGATAACC
AGACAGGCAAACGTCCAACCCCAACAGTGCCAAGATGACC
AAGTGTACAAATCAGGCCAATTTCAAGCAGACAAACAAGA
AAAAGGCTCTGGAGATGTCCTTCAGAAGATAACCAGACAG
GCAAACATCCAACCCCAACAGTGCCAAGATGATCAAGAGT
CCAAATCAGGCCAAGTTCAAGCAGACAAAGAGGAGAATGG
GTCGGGAGATGTCCTACATAAGATAGCCAAAGAGACAAAC
ACCCAACCTCCACAATCCCAAGATGATCAAGAATTCAAAT
CAGGCCAATTTCCAGCAGGCGAATCAGAGAAGGGATCTAG
ATCTGTCCTTCAGGAGATTGCCAGACAGGCAAACATCCAA
TCCCCACATTCCCAAGAAGATCAAGAGTTCAAATCAGGCC
AATTTCAAGTAGCAGAGGAGTGTGTGGAAGCATGTCTCCC
AGTCCCCATATCGGTCTCAAGCATTGAGTCATTGGTGGAC
GGGAAAGCATTGTCGTCATCTAAATTAAGTAACAATAAAG
ATGTCACCGAATCCTATCTTGACACCACCGGTCCAAGAAG
ACGCCCACGGGCCCCGAGTAGCTCAGGAGAGGACGCTGAC
CACCAAAAGACAAAAAGATTGCGACTTGGACAGTCTGCAG
TGTCAAGCGATTCCAACAATCCCTCTTCCGGCTACGCCGC
ACCAGACTCTGTTTGCAGTCCCCAGCCTGAGATTTCACAG
ACTAACCAAAGCGGGCTGGCCACAAGTCTAAGAGGCCTAT
CCGTCAAGCCCGTATCCTCTGGGTCCTCTATTAGTTCCAG
ACCGGCCGCCAGAGAGGAAAGGAAGGGGGGTGAACCCAGA
ACATCCCGATTACGCCGGCTCAAGAAGTCCTGAGGGGTGC
AGTGGCGTACAACGAGAGCGGATATCTGACGCCACCTCCA
TGGATCTTACAGTACACACTTCTACTGTAATGCTGTCTGT
CAGCAGTAGTTGCACAAGAGTTCACCACACACAGCCTTTG
CACATACAGTATTTCGCTTCTGCCTTCCAAGTAATAACAC
ACACACACAAACTGCTTGTATTAGATTACAGAGAAGCTTT
TAAAAGTTTGAATAAGTTCCACTAGCTTTGAAGCAACTCG
TGCAAATCGTAACTTTGCTCTAAACAAAAACACAAATACA
GTTTGCGCATTCTGCGTAAGAGTTGTATTTCAGACTAACG
GGAGCCGCAGAGCACACTGTGGCTCCAAGCCCAAATCTCT
GGCTCCATCCGTCTGAAATCTCCCCTCTTCCAGCTTCAGC
TGAGCACATGATTGATTTCGCTGTGTTCTCACACACACCA
CGCTCTTTAAGCGATCAGGGCTTTTCACCGTTGGAGCCGA
CTGCCGTCTCTTTGCGGTTATTATTTGTAAATGTGTTATT
GCTTTTCGTAACAGCTAAAAGTCTTCTGCGGGATGATTGA
CAACGTTGTGGAACGCTGCAGTGCCTCTCGCGTCCGATAT
TTGGCTAATCACGGGTGCAGTCGACATTGATGTAGTGTGT
GATGGCAGGATGATTATACGTACGGACAGAAATGCTCACA
TGAGAGTCACATGCTCGGTTTTCCAATCGTACTTACAAAT
TACTTGATGTTTATGTCATTAGGATAATAGATATGTGTCA
TGAATATGTTATTAAAATCGATGAATATTGTTTCGTTATA
GCACCATAACAATGCAGAGTTTACAGTTACTGTACAGTAC
TTTTTAAAGTAATTTTACTGTAAATTCTGTAATGAAAACC
ATTAAAGATGGAAATCGTTTGTTTGA

slx4ip TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA slx4ip-203 2386
ncRNA slx4ip-002 (1) 740
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slx4ip-203 Contained in:
[BAC] CH211-159E5 (1)

Genome Resources: Vega_Trans:OTTDART00000040725 (1),  Ensembl_Trans:ENSDART00000144109 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC054616 (1) 2782 bp
CITATIONS (2)