header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-193
Transcript Name: gsc-202
Previous Name: gsc-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000002350 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000002350|OTTDARG00000002180|ZDB-GENE-980528-2060 gsc|OTTDARP00000002079 gsc-002 LG_ AL772209.5 Danio rerio protein_coding KNOWN, 1153 bp
ATGTCCTTAGCTGTTGTTTGTTGTAGTTAATGTTCCAGAT
GTTTATTATACAGCATGATGGAATTTTGGAGCACATCTTA
AAAATACATGCTTCAATTACAACTAAAAAGTTTTTTTTAG
CAGACTTGAGTATTTTTTATAGGTTCTTCGAGAAAAGTAA
TTTTCTGTTTTGACTATGCTTAAAAGTAGCCTAATTATTA
ACGCAAGAACGCATACACCAGAAAAGATTTTTTATAAGAA
AACGGCGGATTGCAGAACGCATCACGTTTTATGCATAAAA
TGTAGACATTTACAATATCTTAGAAATGTCAAATTGATAC
AGTGTACTCAAAAAAGTTGATCTTATTTTCAGGTTATGAC
AGCGCCGGCTCTGTGCTTATTTCTCCAGTCCCACATCAAA
TGATGTCGTACATGAACGTGGGCACCTTGTCCAGAACCGA
GCTACAGCTGCTCAACCAGCTACACTGTCGGCGCAAGAGA
CGACACCGAACCATTTTCACCGACGAGCAGCTGGAGGCAC
TGGAAAACCTTTTTCAAGAAACGAAATACCCTGACGTCGG
CACAAGAGAACAACTGGCACGAAAGGTGCACCTACGTGAA
GAGAAGGTAGAGGTTTGGTTCAAAAACAGACGAGCAAAAT
GGAGAAGACAGAAAAGGTCGTCGTCAGAGGAATCAGAAAA
CTCACAGAAATGGAACAAATCCACGAAAACAACCTCAGAG
AAAATTGAGGAGGGCAAAAGCGACGTGGATTCTGACAGCT
GATATAAAGAACACGAGAACGGGAAATCTTGCACAAATAT
AATTCGGACTTTATTGTACATATTGTAAAGTATGTGAGTT
GGAGTAAATAGTGTTGTCTTGCTGTTGCACAGATGTATAG
TAAATGTTACCTTTAACAATGATATTGTTATTTATATTAA
TTTAAATTTACAGACAAAATAACGTGGATTCTAGCCATAG
TAATATTACCTGGTGTATACTGCAAACGTTTTTAAAGTCT
TGTCGTGATAAGATGTACCTAAATCTGATGTTCTGGAATG
GGCTGTAGCTGAAGACATGTACGATGGCAGGACGATACAT
TCGGACATTAATTAATTTAAAGTTTAATGTCGCCTGAAAA
CAGGAACAAATATTAAAGTAATATCTAAAAAAA

gsc TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA gsc-201 (1) 1276
gsc-202 1153
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gsc-202 Contained in:
[BAC] DKEY-49F1 (1) (order this)

OTHER gsc-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000002350 (1)
  • Ensembl_Trans:ENSDART00000138315 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:L03394 (1) 1164 bp
    CITATIONS (2)