Transcript

gsc-202

ID
ZDB-TSCRIPT-090929-193
Name
gsc-202
Previous Names
  • gsc-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000002350 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000002350|OTTDARG00000002180|ZDB-GENE-980528-2060 gsc|OTTDARP00000002079 gsc-002 LG_ AL772209.5 Danio rerio protein_coding KNOWN, 1153 bp
ATGTCCTTAGCTGTTGTTTGTTGTAGTTAATGTTCCAGAT
GTTTATTATACAGCATGATGGAATTTTGGAGCACATCTTA
AAAATACATGCTTCAATTACAACTAAAAAGTTTTTTTTAG
CAGACTTGAGTATTTTTTATAGGTTCTTCGAGAAAAGTAA
TTTTCTGTTTTGACTATGCTTAAAAGTAGCCTAATTATTA
ACGCAAGAACGCATACACCAGAAAAGATTTTTTATAAGAA
AACGGCGGATTGCAGAACGCATCACGTTTTATGCATAAAA
TGTAGACATTTACAATATCTTAGAAATGTCAAATTGATAC
AGTGTACTCAAAAAAGTTGATCTTATTTTCAGGTTATGAC
AGCGCCGGCTCTGTGCTTATTTCTCCAGTCCCACATCAAA
TGATGTCGTACATGAACGTGGGCACCTTGTCCAGAACCGA
GCTACAGCTGCTCAACCAGCTACACTGTCGGCGCAAGAGA
CGACACCGAACCATTTTCACCGACGAGCAGCTGGAGGCAC
TGGAAAACCTTTTTCAAGAAACGAAATACCCTGACGTCGG
CACAAGAGAACAACTGGCACGAAAGGTGCACCTACGTGAA
GAGAAGGTAGAGGTTTGGTTCAAAAACAGACGAGCAAAAT
GGAGAAGACAGAAAAGGTCGTCGTCAGAGGAATCAGAAAA
CTCACAGAAATGGAACAAATCCACGAAAACAACCTCAGAG
AAAATTGAGGAGGGCAAAAGCGACGTGGATTCTGACAGCT
GATATAAAGAACACGAGAACGGGAAATCTTGCACAAATAT
AATTCGGACTTTATTGTACATATTGTAAAGTATGTGAGTT
GGAGTAAATAGTGTTGTCTTGCTGTTGCACAGATGTATAG
TAAATGTTACCTTTAACAATGATATTGTTATTTATATTAA
TTTAAATTTACAGACAAAATAACGTGGATTCTAGCCATAG
TAATATTACCTGGTGTATACTGCAAACGTTTTTAAAGTCT
TGTCGTGATAAGATGTACCTAAATCTGATGTTCTGGAATG
GGCTGTAGCTGAAGACATGTACGATGGCAGGACGATACAT
TCGGACATTAATTAATTTAAAGTTTAATGTCGCCTGAAAA
CAGGAACAAATATTAAAGTAATATCTAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations