header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-192
Transcript Name: gsc-201
Previous Name: gsc-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000002349 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000002349|OTTDARG00000002180|ZDB-GENE-980528-2060 gsc|OTTDARP00000002078 gsc-001 LG_ AL772209.5 Danio rerio protein_coding KNOWN, 1276 bp
ACAAACGAGTCTCTGAATCTGTTGCGCGCGGTCACTCTTA
CAACAGGAAACAAACAGAATTCGCGGTTTTTGTCACTATG
AAGGACACTCGTGCTTTTTAAAAGGACTAAAATAACACGT
TATTACCGTTGGCAACAAATCTCACACATCTTTTCGCTTG
TGATGCCCGCTGGGATGTTTAGTATCGACAGCATCTTGGC
CGGGAGACCCAGCTGCAAAGACTCGGTTCTGCTCCACCGG
AATGCCCCGGTTGTGTTCTCCAACTTGACGGAATCCTTGT
ACACGGCAGCTGGCGATTTTAATGGACTGTATTCACACAC
AGGACCTCCAGCGCCGAACTTACAATCGGTGAATGGAAGG
ATAGGCTACAACAACTACTACTATGGACAACTTCACGTCC
AGGGGCCGACTGGACCAGCTTGCTGTGGCGCAATACCAAC
CCTTGGTTCGCAACAGTGTCCGTGTATTCATACAGGTTAT
GACAGCGCCGGCTCTGTGCTTATTTCTCCAGTCCCACATC
AAATGATGTCGTACATGAACGTGGGCACCTTGTCCAGAAC
CGAGCTACAGCTGCTCAACCAGCTACACTGTCGGCGCAAG
AGACGACACCGAACCATTTTCACCGACGAGCAGCTGGAGG
CACTGGAAAACCTTTTTCAAGAAACGAAATACCCTGACGT
CGGCACAAGAGAACAACTGGCACGAAAGGTGCACCTACGT
GAAGAGAAGGTAGAGGTTTGGTTCAAAAACAGACGAGCAA
AATGGAGAAGACAGAAAAGGTCGTCGTCAGAGGAATCAGA
AAACTCACAGAAATGGAACAAATCCACGAAAACAACCTCA
GAGAAAATTGAGGAGGGCAAAAGCGACGTGGATTCTGACA
GCTGATATAAAGAACACGAGAACGGGAAATCTTGCACAAA
TATAATTCGGACTTTATTGTACATATTGTAAAGTATGTGA
GTTGGAGTAAATAGTGTTGTCTTGCTGTTGCACAGATGTA
TAGTAAATGTTACCTTTAACAATGATATTGTTATTTATAT
TAATTTAAATTTACAGACAAAATAACGTGGATTCTAGCCA
TAGTAATATTACCTGGTGTATACTGCAAACGTTTTTAAAG
TCTTGTCGTGATAAGATGTACCTAAATCTGATGTTCTGGA
ATGGGCTGTAGCTGAAGACATGTACGATGGCAGGACGATA
CATTCGGACATTAATTAATTTAAAGTTTAATGTCGCCTGA
AAACAGGAACAAATATTAAAGTAATATCTAAAAAAA

gsc TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA gsc-201 1276
gsc-202 (1) 1153
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gsc-201 Contained in:
[BAC] DKEY-49F1 (1) (order this)

OTHER gsc-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000002349 (1)
  • Ensembl_Trans:ENSDART00000082085 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:L03395 (1) 1252 bp
    GenBank:BM736105 (1) 720 bp
    GenBank:BI704469 (1) 418 bp
    GenBank:BM735914 (1) 410 bp
    CITATIONS (2)