Transcript

racgap1-003

ID
ZDB-TSCRIPT-090929-18757
Name
racgap1-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038374 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038374|OTTDARG00000028234|ZDB-GENE-030131-1917 racgap1|no_translation racgap1-003 LG_ CR354542.8 Danio rerio protein_coding KNOWN, 845 bp
GTGCCAAATCTTGGCCTGGCTTTCGTAATGTAATGTTTTT
GGCCATTTTCCTTTATGTAAACATAAATCATTTTAAAAAC
AGTGTGTAAACATGTAACTTGTTATGTTGTAAACATACCC
TAACTCTTGAGCACTACCTATAATACGCACATATTGCTTT
GTCAGACTGGTTTGTACCGGGTATCTGGCTCTGATCGAGT
GGTCAAGGACCTGAAAGAAAAGTTCCTGCGTGGGAAGACT
GTTCCCCTGCTCAGCAAGGTGGAAGACATCCATGCTATCA
CTGGCCTCCTCAAGGACTTCCTAAGGAACCTCAAAGAGCC
CCTGCTAACCTTCCGCCTCAATCGGGCATTCATGGATGCT
GCAGAGCTGTCAGATGATGACAACAGCATTGCCTTGATGT
ATCAGAACATCAGTGATCTTCCACAGCCCCACAGAGACAC
TCTGGCCTTCCTCATCATCCATCTACAAAGGGTGGCCCAA
AGCCCCGCTACAAAGATGGACATCACCAATCTGGCTCGTG
TATTTGGACCCACAATTGTAGGCCATGCCGTTTCTAACCC
AGAACCAATGACCATCCTACAGGACACAAAACGACAACCG
AGGGTGGTCGAGCGTCTCCTCAGTCTGCCTGTGGAGTACT
GGAGTCAGTTTATGATAAGCGACCACGACCATGCTCGCAA
TGATCACATGATCATCGAGAACGCCAATGTTCACACGACT
CCAGATCAGAAAATGAGTATGTTTGGTCCCATTACGACTC
CTGACCAGCAGATGAGCAAGACTCCATCATCCAGCTCTCT
CTCCCAGCGCATGAAGAACGCAACTCTCAATGCTATCACT
CCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations