Transcript

racgap1-202

ID
ZDB-TSCRIPT-090929-18756
Name
racgap1-202
Previous Names
  • racgap1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038373 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038373|OTTDARG00000028234|ZDB-GENE-030131-1917 racgap1|OTTDARP00000030749 racgap1-002 LG_ CR354542.8 Danio rerio protein_coding KNOWN, 1389 bp
TTTTAAAAAGTTTATAATCTCGGATCGCATCGCTTCACAC
GCAAGGCTGGGTGTCTACAGAAATCCGAGGACATGGAGAC
CGCTGTGATGAATCTTCACAGCATTTTCGAAAGCCTGCGG
GCACAAGCTGATGTTCTCAATGAAAGCATTGAGCCCCAGT
TCATTCAGCTGGCCATAAACTTTGAGGACAACCGTCGTAG
ATGGCTGAGACTCGAACAGGAGCTGAATGCATGCAAAGAA
GTGCTCACTAAAGCTGAGACGGAGCGTGGAGCTCTGGAGG
TCAAGCTCAAACATGCTCGTAACCAAGTAGATGTGGAGAT
CCGTAGAAGACAGAAAGCCGAGTCTGACTGCGCAAAGCTG
GACCGTCAGATCCAGCTCATCCGGGAGCTGCTGGTTTCTG
AAGGCTCTAGTAGCAGCATCCAGTTAAATGAGGAGCAGCG
CTCTGCTCTGGCCTTCCTAAATGCCCGTTCTCAGAATCCT
GCAAATTTGAACACTAGCAGACGACTGGCTACCATTGATG
AATCAGCCTCTATCTTGTCAGACATCAGCTATGACAAAAC
GGATGATTCTTTGGACTGGGACTCTTCTGCAATCAGAACC
GTTCGTCTTAAGAAACGGCAAAAGAGACGCTCTTCCCGAA
ACCACACCGAAGGACCTCCAGCTGCTGCTAAAAGGTCTCG
CTCCACCGGCCGGACATCAGAGAAAGGAAATGAGTCTCTG
GTGGCTAAAACCACCGTGACTGTGCCTGCTGATGGCGGAC
CCATTGAGGCCGTCACCACAGTGGAGGCTGTTCCCTACTG
GACCAGGAGCCGCCGGAAGACTGCTGCTGTGGAGTGGGAC
ACCGTTGACACAGATTCTGTTCAGTCTATGGATGTGTTCA
AGCAGCCCAGTCTGCCCAATGCAGAGAACAGGGCAGAGCC
CAGCACTCCACAGGGCAACGGAGGTGTCCGTCTGCATGAG
TTTATCTCCAAAACGGTGATCAAGCCAGAGTCTTGTGTGC
CATGTGGTAAGAGGATCAAGTTTGGCAAGATCTCTTTAAA
GTGTCGGGACTGTCGTGTAGTGGCCCACCCAGAGTGCCGT
GAACGCTGCCCATTGCCCTGCATTCCATCCATGACTGGGA
CTCCTGTCAAAATCGGAGAGGGTACACTAGCAAACTACGT
GTCTAACACCTCTCCCATGATCCCTTCGCTAGTGGTGCAC
TGCATTAATGAGATTGAGCAGAGAGGCCTACATGAGACTG
GTTTGTACCGGGTATCTGGCTCTGATCGAGTGGTCAAGGA
CCTGAAAGAAAAGTTCCTGCGTGGGAAGACTGTTCCCCTG
CTCAGCAAGGTGGAAGACATCCATGCTATCACTGGCCTCC
TCAAGGACTTCCTAAGGAACCTCAAAGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations