Transcript

ccng1-004

ID
ZDB-TSCRIPT-090929-18255
Name
ccng1-004
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037858 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037858|OTTDARG00000027958|ZDB-GENE-020322-1 ccng1|no_translation ccng1-004 LG_ CU062437.8 Danio rerio protein_coding KNOWN, 704 bp
AGATGATTGACCAGGTGACCGAAACGGGGGCTTTGCCCTT
TACAGTCCAGCTCAAATCTCTTCTAGACCAAGAGTCCAGA
TATCAGCCCAAACTCTGTGGACTCCGCGTCATCGAGTCCG
CTCAGGATAATGGTCTGCGAATGACCGTCAAGCTGAGAGA
CTATCAAGTGAGAGAGCTTCTCTCCTTGACTCGATTCTTT
GGCTTCTGTGCGGAGACGTTTTCCTTTGCCGTGAATCTCC
TAGATCGATTCCTGGCTGTGATGAAGATTCAGCCCAAGCA
TCTGTCTTGTGTGGGTCTGTGCTGCTTCTACATCGCTGTG
AAGACTTCAGAAGAGGAGAAAAATGTCCCTCTGGCCAGTG
ACCTCATCAGGATCAGCCAGAATCGCTTCACTGTTCATGA
CATGATGAGGATGGAGAAGATCATTCTGGAAAAGCTCAAC
TGGAAGGTCAAGGCTCCGACTGCTCTTCACTTCCTCAGAT
TCTTTCACTCTCATATTCAAGAGAAAGTGGACACAGAAAG
GTGAATGACTTGACCCCCATATATACATTGTTTGTTTTTG
ACACAATTATTTTATTAAGACAAACTTTTTATTGAAGTGA
AACTGCATGTATGATTTGGAACAGTTTGAACAGGTACTGT
GTAGACCTGGTGTCCGTTCTTCCTACGTGGATTACTGAAT
TAGCTTTATTTGGATATTGACTAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations