header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-18252
Transcript Name: ccng1-201
Previous Name: ccng1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037855 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037855|OTTDARG00000027958|ZDB-GENE-020322-1 ccng1|OTTDARP00000030338 ccng1-001 LG_ CU062437.8 Danio rerio protein_coding KNOWN, 1941 bp
ACTGCCTGACGCCAAGGGTTGGGGTGTGCAGGGCAGAAGT
AAAACTTGCTTTAAACTTACATACTGAGAACATTCTTCTT
TTTTTTCCCACTTTTAATAGTTTCTTCTTTAATATTTTAT
TTAATAAACTCTTAAATATTTGTTTTAAAAAAAGTCATAT
AATCGCCAAAAGATGATTGACCAGGTGACCGAAACGGGGG
CTTTGCCCTTTACAGTCCAGCTCAAATCTCTTCTAGACCA
AGAGTCCAGATATCAGCCCAAACTCTGTGGACTCCGCGTC
ATCGAGTCCGCTCAGGATAATGGTCTGCGAATGACCGTCA
AGCTGAGAGACTATCAAGTGAGAGAGCTTCTCTCCTTGAC
TCGATTCTTTGGCTTCTGTGCGGAGACGTTTTCCTTTGCC
GTGAATCTCCTAGATCGATTCCTGGCTGTGATGAAGATTC
AGCCCAAGCATCTGTCTTGTGTGGGTCTGTGCTGCTTCTA
CATCGCTGTGAAGACTTCAGAAGAGGAGAAAAATGTCCCT
CTGGCCAGTGACCTCATCAGGATCAGCCAGAATCGCTTCA
CTGTTCATGACATGATGAGGATGGAGAAGATCATTCTGGA
AAAGCTCAACTGGAAGGTCAAGGCTCCGACTGCTCTTCAC
TTCCTCAGATTCTTTCACTCTCATATTCAAGAGAAAGTGG
ACACAGAAAGTAAGAAGATTCTGAACATCGAGAGGCTTGA
GGCACAGTTAAAGGCATGCCATTGCTCATTTACTTTCACT
AAACTAAAGCCTTCCCTGCTTGCTTTGTCTCTTCTGGCCC
TGGAGATTGAGGATCAGCACGAGTATGAGCCAGTTCCATC
TCTAAAAGAGGCTCTAGATGGTCTGCAGCAGAGTTTAAAT
GTTAAAGTTGGAGACCTGGTTTGTGTGAGGGAGCTTGTTG
CCAAGTGCCTGGTTGAATATTCCAGCACCAAGTGCCAGAA
GCCAAATGGCCAGAGACTGCGGTGGATGATTTCTGGTAGA
ACTGCCAGACAACTGAAGCACAGTTACTATAAGATCGCCC
ATCTACCTACAATTCCTGAATATGCTTGTTAAGACTATTA
GTGTTGAGTGCCCATAACTGAACAACATTCAGTCCTATGG
GTGAATGGCTTGACTGTCATCACATTTTCTGCCTTCAGAC
TATGGTTTTATATAGTTTGTAAAGATGATGTTATGGGTAC
CTAACTCTAAATTCCTACTCACTTCCCCAGTCTTTATATT
TTCACGTTAACACTTTTCCATAATTGTATTCATTTACATT
GACATTGATTCTATCTTGATTACTAGTCAAAAGTGGTTTT
CAGCAAGTTACTTATGGCTTCTACTGGTAAGGCTTGCTCA
TGTACAGTATGTTCATTTGGATCGGTGCAAAAAGCGCTGG
TTGTTTGAAGCAATGAAGTATAGAACCGCCTAGGTCCTCA
GTCCACTGTGTGGAAGAGGAGGGAGAAGGGTTTTGAGATT
CAAACTACAACAATAGAACCAAGAGATCAGGCCCGAAACC
CTTAACTCCCACCCTAGGTTGTCGGCTGTCGAAATGCACA
CTCCTACCCAAGGTGATGAAACGAGATGTTTTCTTTTCTT
CTGCTTTCTAATGTGGAATGGCTTTGGAAATGCAGGTTTT
AACTTGATTTAATATGCCTTTAAGAGGAAGGATTAGTTAA
GTACTTATTGACCGGTGTTTTTTTGTTTTGTTTTTGGACA
TTTGGTTAATACTACAGTATCTATGACCATTTGTTTTACG
CCTGGTTTCAATAAAACTAACACAAAACAAAAAAAAAGAG
TGACACAAATAAAACTGTTGAAATGGATTGTGTTATTTGA
AATTGCTCCTTTTTGTTTTGGCTCTAATCTGGAATTTGAA
AGCAGTTTTCTGCAAATTGATGTAGTTGAACCTTTCAATA
AAACTTTATTGAAATGTAAAA

ccng1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ccng1-004 (1) 704
mRNA ccng1-201 1941
ccng1-202 (1) 529
ccng1-203 (1) 741
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ccng1-201 Contained in:
[BAC] CH73-25I20 (1) (order this)

OTHER ccng1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000037855 (1)
  • Ensembl_Trans:ENSDART00000109065 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC052125 (1) 1963 bp
    GenBank:BC066576 (1) 1959 bp
    GenBank:AY423016 (1) 1762 bp
    GenBank:CN024375 (1) 912 bp
    GenBank:EH444124 (1) 850 bp
    GenBank:EH486793 (1) 696 bp
    GenBank:EB838821 (1) 315 bp
    CITATIONS (2)