Transcript

ccng1-203

ID
ZDB-TSCRIPT-090929-18254
Name
ccng1-203
Previous Names
  • ccng1-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037857 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037857|OTTDARG00000027958|ZDB-GENE-020322-1 ccng1|OTTDARP00000030339 ccng1-003 LG_ CU062437.8 Danio rerio protein_coding KNOWN, 741 bp
TGGTTGACGGACATGCCCAGACATGACCAGCGGTCCTCGC
GCACAGTCAGTGACGCTTCAGTCTGTGGAGCCCAGCTCTA
CAACACCGCGTTCACGATTATTAAGCGCAAATTAATATAA
AAAAGCAGTTTAGAGAAATGACTTAATTTTTTTTAAATGA
GTCAGTTTCGTAAGCCTGAACATGCCCGGGCATGACATGT
CGCGTTCATTCAACGCGTCGTTTTTCAAAATGGACACTTG
TATTAACTGCCCTACATGATGATTGACCAGGTGACCGAAA
CGGGGGCTTTGCCCTTTACAGTCCAGCTCAAATCTCTTCT
AGACCAAGAGTCCAGATATCAGCCCAAACTCTGTGGACTC
CGCGTCATCGAGTCCGCTCAGGATAATGGTCTGCGAATGA
CCGTCAAGCTGAGAGACTATCAAGTGAGAGAGCTTCTCTC
CTTGACTCGATTCTTTGGCTTCTGTGCGGAGACGTTTTCC
TTTGCCGTGAATCTCCTAGATCGATTCCTGGCTGTGATGA
AGATTCAGCCCAAGCATCTGTCTTGTGTGGGTCTGTGCTG
CTTCTACATCGCTGTGAAGACTTCAGAAGAGGAGAAAAAT
GTCCCTCTGGCCAGTGACCTCATCAGGATCAGCCAGAATC
GCTTCACTGTTCATGACATGATGAGGATGGAGAAGATCAT
TCTGGAAAAGCTCAACTGGAAGGTCAAGGCTCCGACTGCT
CTTCACTTCCTCAGATTCTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations