header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-18254
Transcript Name: ccng1-203
Previous Name: ccng1-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037857 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037857|OTTDARG00000027958|ZDB-GENE-020322-1 ccng1|OTTDARP00000030339 ccng1-003 LG_ CU062437.8 Danio rerio protein_coding KNOWN, 741 bp
TGGTTGACGGACATGCCCAGACATGACCAGCGGTCCTCGC
GCACAGTCAGTGACGCTTCAGTCTGTGGAGCCCAGCTCTA
CAACACCGCGTTCACGATTATTAAGCGCAAATTAATATAA
AAAAGCAGTTTAGAGAAATGACTTAATTTTTTTTAAATGA
GTCAGTTTCGTAAGCCTGAACATGCCCGGGCATGACATGT
CGCGTTCATTCAACGCGTCGTTTTTCAAAATGGACACTTG
TATTAACTGCCCTACATGATGATTGACCAGGTGACCGAAA
CGGGGGCTTTGCCCTTTACAGTCCAGCTCAAATCTCTTCT
AGACCAAGAGTCCAGATATCAGCCCAAACTCTGTGGACTC
CGCGTCATCGAGTCCGCTCAGGATAATGGTCTGCGAATGA
CCGTCAAGCTGAGAGACTATCAAGTGAGAGAGCTTCTCTC
CTTGACTCGATTCTTTGGCTTCTGTGCGGAGACGTTTTCC
TTTGCCGTGAATCTCCTAGATCGATTCCTGGCTGTGATGA
AGATTCAGCCCAAGCATCTGTCTTGTGTGGGTCTGTGCTG
CTTCTACATCGCTGTGAAGACTTCAGAAGAGGAGAAAAAT
GTCCCTCTGGCCAGTGACCTCATCAGGATCAGCCAGAATC
GCTTCACTGTTCATGACATGATGAGGATGGAGAAGATCAT
TCTGGAAAAGCTCAACTGGAAGGTCAAGGCTCCGACTGCT
CTTCACTTCCTCAGATTCTTT

ccng1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ccng1-004 (1) 704
mRNA ccng1-201 (1) 1941
ccng1-202 (1) 529
ccng1-203 741
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ccng1-203 Contained in:
[BAC] CH73-25I20 (1) (order this)

OTHER ccng1-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000037857 (1)
  • Ensembl_Trans:ENSDART00000138274 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CV103779 (1) 760 bp
    CITATIONS (2)