header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-18217
Transcript Name: ift20-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037820 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037820|OTTDARG00000027939|ZDB-GENE-040614-2 ift20|no_translation ift20-002 LG_ CR848814.7 Danio rerio protein_coding KNOWN, 818 bp
CGGTCGGTCGGTCCAACAGAAGTGCCACATAACCAAACAA
AAGTCAGCCATTATTGAGTCACACAGGCAGGTTACGGTCC
TCTGGTCATGGCTAAAGACCCGTTAGCAGAGGCTGGTCTT
CATTTTGATGAGCTCAACAAACTGCGAGTACTTGAGCCTG
ATGTGAGCCAGAAAACAACTGAGCTCAAAGAGGAATGTGA
GGAGTTTGTCGACAAGATCGGACAGTTTCAGAAAATTGTA
GGTGGACTTATTGAACTTGTGGATGAACTTGCGAAGGAAG
CCGAAACTGAAAAAATGAAGGTACGTTGTTGTTTTAAACT
ATTAGCAGTGCATATTTGCGTTTTGTATTTATATATGGTT
CACCTTCAGGCCATAGGGGCAAGAAATTTGCTGAAATCGG
TTGAAAAGCAACGGGAAGCCCAGCAGCAACAGCTTCAGGC
TCTGATTGCAGAGAAGAAAATGCAACTGGAAAGGTATCGA
ATAGAATATGAAGCTCTTCAGAAAGTGGAAGCTGAGCAGA
GTGAATTCATTGATCAGTTTATACTGCAGAAATAAGAGCA
CTGTGTTTCCTCTCTCTGCTGGACAGGAAAAATGATGCTA
TGCATCTTGATTCACATTGACTTCCTAATAAGTGCAAGGT
CTCAAACTAGATGAACTGAATTGAGCAGTTATGGCAGACA
ACAGACGTCTGTTTCAGCCTCAACCTCACAGCATTGAGTG
CTTTTGCATGGCCAGTTCCTGGAGGCACATCCTTGTAATC
TTTCCAACCATAGATCATAATCTCAGATGAAACTATTTAT
ATACAAATGTTATTTATA

ift20 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ift20-202 (1)    Ensembl 1104
ncRNA ift20-002 818
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ift20-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000037820 (1),  Ensembl_Trans:ENSDART00000132777 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:DV595634 (1) 868 bp
GenBank:DV596078 (1) 798 bp
CITATIONS (2)