header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-18216
Transcript Name: ift20-202
Previous Name: ift20-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037819 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037819|OTTDARG00000027939|ZDB-GENE-040614-2 ift20|OTTDARP00000030313 ift20-001 LG_ CR848814.7 Danio rerio protein_coding KNOWN, 1104 bp
ATGCGAGGAAGCGGTCGGTCGGTCCAACAGAAGTGCCACA
TAACCAAACAAAAGTCAGCCATTATTGAGTCACACAGGCA
GGTTACGGTCCTCTGGTCATGGCTAAAGACCCGTTAGCAG
AGGCTGGTCTTCATTTTGATGAGCTCAACAAACTGCGAGT
ACTTGAGCCTGATGTGAGCCAGAAAACAACTGAGCTCAAA
GAGGAATGTGAGGAGTTTGTCGACAAGATCGGACAGTTTC
AGAAAATTGTAGGTGGACTTATTGAACTTGTGGATGAACT
TGCGAAGGAAGCCGAAACTGAAAAAATGAAGGCCATAGGG
GCAAGAAATTTGCTGAAATCGGTTGAAAAGCAACGGGAAG
CCCAGCAGCAACAGCTTCAGGCTCTGATTGCAGAGAAGAA
AATGCAACTGGAAAGGTATCGAATAGAATATGAAGCTCTT
CAGAAAGTGGAAGCTGAGCAGAGTGAATTCATTGATCAGT
TTATACTGCAGAAATAAGAGCACTGTGTTTCCTCTCTCTG
CTGGACAGGAAAAATGATGCTATGCATCTTGATTCACATT
GACTTCCTAATAAGTGCAAGGTCTCAAACTAGATGAACTG
AATTGAGCAGTTATGGCAGACAACAGACGTCTGTTTCAGC
CTCAACCTCACAGCATTGAGTGCTTTTGCATGGCCAGTTC
CTGGAGGCACATCCTTGTAATCTTTCCAACCATAGATCAT
AATCTCAGATGAAACTATTTATATACAAATGTTATTTATA
CTATTTATATGAAAATTAGTTTGTAAATCTGATCTTTTTT
TTTACAATAGGGAAATACAGTATTTGCATGTTACTGTAAA
TAATTCCATCATGTGACATCTTCAGGTAAATCTATTGTTT
TCTGTATGATTACAACTCCTGTTTGAGACTTGAACCCATG
TCGTTTTTATTATATCATATCCTCATGATATTTTTATTGG
GACCAAACCAAAATAATTTCAGTAGAAGTTATGGAAAAGT
AAGTTCATTTATTACTTGTTTACATTTACCATGTGTAATC
TCAACATTGGGCAAAGCTCATAAAGATCTGAAGAACATTT
GAATAAAAATATATTTTGCATTTA

ift20 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ift20-202 1104
ncRNA ift20-002 (1)    Ensembl 818
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ift20-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000037819 (1),  Ensembl_Trans:ENSDART00000138375 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC081508 (1) 1137 bp
GenBank:CN023025 (1) 934 bp
CITATIONS (2)