Community Action Needed: Please respond to the NIH RFI
Transcript

gata1a-002

ID
ZDB-TSCRIPT-090929-17734
Name
gata1a-002
Previous Names
  • gata1-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037311 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037311|OTTDARG00000027654|ZDB-GENE-980526-268 gata1a|no_translation gata1a-002 LG_ CR932000.4 Danio rerio protein_coding KNOWN, 730 bp
CAACATCGATGTTGCAATGTCATTAAAATACATTCAGTTA
AATAGACTTTGGCATTCATTTAGTTGCTCAAGCGCAAAAC
AAGACAAAATGCCGTTTACTCGCACGCACCCATCAGAATC
GGCAGGCTAGCACAGAAGCTCCACTGAATATACTGGGGTA
AAATAAATGCTCATATTATAAAGACATGGTGGGGAAAAAT
GTAATTTAATGCGGTGCTTCTTGTACAATCTGAGACCAGC
TTTATATTAGATATCACTCAGCCAGTGGAGATGGCTGATT
TTTAAAGAAAACAGACCTTAAACGATTTTGCAATGGCATT
TAGTTCACCAGAAGCGTTTAATCTGTGGCAAATTAAAAGT
CCTGTTAGCATACTTTGGCATATACCCCATTGGTTATAAT
GAACTAAATAATTATACAAAAAATTGTCTCCTGCATCAGA
TTGTCAGCAAACGTGCTGGAACGCAGTGCGCCAACTGCCA
CACTAGTACTACAACACTATGGAGACGCAATGCCAGCGGC
GAGCCTGTGTGCAACGCCTGCGGCCTTTATTTTAAACTAC
ACAATGTCAACAGGCCTTTGACAATGAAGAAGGATGGCAT
ACAAACTCGAAACCGCAAGGTTTCAAACAGAAACAAGAAG
GGCAAAAAGAATGCAGCTTCAGAAGTTTATCCTGACATGT
CTCACATGGCACCTCCAGATGAGCATGTAGGAGCGTATTC
TCTGAACCCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations