Community Action Needed: Please respond to the NIH RFI
Transcript

gata1a-201

ID
ZDB-TSCRIPT-090929-17733
Name
gata1a-201
Previous Names
  • gata1-001
  • gata1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037310 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037310|OTTDARG00000027654|ZDB-GENE-980526-268 gata1a|OTTDARP00000029896 gata1a-001 LG_ CR932000.4 Danio rerio protein_coding KNOWN, 1657 bp
GAGATAAGCAAGCAAACAGGCGGCTAGTTCACTCCATGAT
CTGAGAATCTCCTGATACTGATAAACGACATCTTCAATAC
TACACTTGCAGATGGAGAACTCCTCTGAGCCTTCTCGTTG
GGTGTCCCCCGGTCTGCTCAGTCCAGACCCATTGGTAAAC
TACACAACAGACTCTGGTTTACTGCCACCCGTTGATGTAG
ATGAACCTTTCTACTCCAGCTCTGAGACTGACCTACTGCC
ATCGTATTATTCCACCAGCGTCCAGAGCCGAGCCTCGTCA
TCCTATAGACACAGTCCAGTTCGCCAAGTTTACTCATCTC
AGTCAATTCTGGGAAACATCCAATGGCTAGACAACTCTGC
AGGTCACTCTCTAAACTCTCCCTACAACCCCACATCCACG
GTCTGGTCCAGTAGCCCTTTCGCAAAAACACCTCTCCACT
CTCACACCTCCACGTCCATCTACCAGAACACTGCCACTCC
ATCTTTCACCTCCCCCAAAGAGGGCTTCCCTTCCCCGAGT
CGTGATGGGAAAGACAGTCCCAGGCTCCAGGAAGTCCTGA
AAGCCGAGCGCTTGAGTCCCATGAGTGGAAGTGGAAGCAG
CTTTCTCAATCTGAGTTCAGCCACTGGAGGAGTTTACGGC
CCTTCTCCACACATGCTGAGTCCATATGGATCCTACATGA
GCACATCTCAAGACTACAGTTCAGCAGCGCTCTATTCAAC
TGGGGGACCCTGGATGAGCCCTTCATCGTACTCACCCAAA
CTGCGCAACAAGATGAGACTTTCGCCACCTGAGGCTCGTG
AATGTGTGAATTGTGGTGCCACCGCCACCCCTCTGTGGCG
TCGAGATGGGACAGGCCACTACCTCTGTAATGCTTGTGGA
CTGTACCATAAGATGAACGGCCAGAACAGACCCCTCATCA
GACCAAAAAAGAGGCTGATTGTCAGCAAACGTGCTGGAAC
GCAGTGCGCCAACTGCCACACTAGTACTACAACACTATGG
AGACGCAATGCCAGCGGCGAGCCTGTGTGCAACGCCTGCG
GCCTTTATTTTAAACTACACAATGTCAACAGGCCTTTGAC
AATGAAGAAGGATGGCATACAAACTCGAAACCGCAAGGTT
TCAAACAGAAACAAGAAGGGCAAAAAGAATGCAGCTTCAG
AAGTTTATCCTGACATGTCTCACATGGCACCTCCAGATGA
GCATGTAGGAGCGTATTCTCTGAACCCAGGACCCCTTCTG
TCCTACAGTCACCCGGCTCATCTACTGCCAACTTCCACCT
TACACTCCTCTACCACTTTGCCCTACACCCATCACCCAAA
CTCTGGCATGATGCCCACACTAGTGTGAAGGAAACATCCA
CGGGACCATAACGAAGCTTGTAAATTATGTTGTACACACT
TTTTGTTTCCCTCAATAAATGCATCCCGTCCTATTTTTAT
TGAAAGAGATGCATTAAAGCTGCTCCATATCTGCTGCAGT
CAAACAGCTTGTCAGTGATATTTGAACCTGTTGTGTAGTT
GAATAGAAAAACATGGCTGAAACTGTGAGCTATATCATTT
AAATGTAAATATTGATGATTGTATGGCTTATTGTATGTGC
TTTAATCAGACTATTACGACTTCTTTTGAGACGTTCAATA
AATGTCTTGTACTTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations