Transcript

atg9a-203

ID
ZDB-TSCRIPT-090929-17065
Name
atg9a-203
Previous Names
  • atg9a-003
  • zgc:158700-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036602 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036602|OTTDARG00000027274|ZDB-GENE-070209-65 atg9a|OTTDARP00000029362 DKEY-264E9.1-003 LG_none BX539326.8,CT963095.5 Danio rerio protein_coding KNOWN, 539 bp
GAAAGGATAACTAATAAGACGTCTAAACGAAATCTTACGA
CTGTAGGTTAATGCTACCCAATTCTGTGCCTTTTGAAAAG
GACTGAATGTCGAAGCTTTGCTGTTTCATCTATAGGAAGA
GCAGAATTGGACCCACAACGTAACTCCTTTTGCTTTCATA
TACCCTATGAAATGGCGGGAGGTACAAGGCAGCAGCAGAA
GGGATAGTGTGTGACAGAAGATTTAGGGTCTCACAGCAGG
ATGGCCCACTTTGATACGGAGTACCAGCGCCTGGAGGCGT
CTTACAGTGACTCCCCTCCTGGAGAAGAGAATCTGCTGGT
CCATGTTCCAGAGGGATCCAAATCTCCATGGCACCACATC
GAAAATCTGGACCTCTTCTTCCAGAGAGTCTATAATCTAC
ACCAAAAGAATGGATTTACCTGTATGCTGCTGGGAGAAAT
ATTTGAGCTTGTGCAACTGGTGTTCGTGGTGGCATTCACA
GTGTTCCTGGCTAACTGTGTGGACTATGACATCCTCTTTG
CCAACAAGTTTGTTAATCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations